Incidental Mutation 'R3442:Mynn'
ID267404
Institutional Source Beutler Lab
Gene Symbol Mynn
Ensembl Gene ENSMUSG00000037730
Gene Namemyoneurin
SynonymsSBBIZ1, 2810011C24Rik
MMRRC Submission 040660-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R3442 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30602065-30619873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30613563 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 471 (F471L)
Ref Sequence ENSEMBL: ENSMUSP00000041034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047502] [ENSMUST00000192715] [ENSMUST00000195396] [ENSMUST00000195751]
Predicted Effect probably damaging
Transcript: ENSMUST00000047502
AA Change: F471L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041034
Gene: ENSMUSG00000037730
AA Change: F471L

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192715
AA Change: F499L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730
AA Change: F499L

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193736
Predicted Effect probably benign
Transcript: ENSMUST00000195396
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195751
SMART Domains Protein: ENSMUSP00000141450
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Meta Mutation Damage Score 0.4337 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ and zinc finger domain-containing protein family that are involved in the control of gene expression. Alternative splicing results in multiple transcript variants and a pseudogene has been identified on chromosome 14. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,656 Y26* probably null Het
Adam30 T C 3: 98,162,570 I573T probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Dbt T A 3: 116,548,191 D480E probably benign Het
Dmbt1 G A 7: 131,106,249 C1407Y probably damaging Het
Frem3 C T 8: 80,613,040 P654L probably damaging Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gpx1 C G 9: 108,339,350 T13S probably benign Het
Grik3 C A 4: 125,693,970 L628M probably damaging Het
Grik3 T A 4: 125,693,971 L628Q probably damaging Het
Gsap A G 5: 21,278,127 Y610C probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Msmb A G 14: 32,150,216 N55D probably benign Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Olfr1501 T C 19: 13,839,006 T56A possibly damaging Het
Otof T C 5: 30,371,689 R1792G probably damaging Het
Sil1 A T 18: 35,325,396 L182H probably damaging Het
Sla C T 15: 66,783,660 G210D probably benign Het
Slc26a7 C T 4: 14,565,511 V191M probably benign Het
Trrap A G 5: 144,792,252 M659V probably benign Het
Ubxn6 G T 17: 56,069,049 Q371K probably benign Het
Zfat A T 15: 68,084,553 D1143E probably benign Het
Zfat C T 15: 68,101,581 A1122T probably damaging Het
Zfp950 A T 19: 61,118,732 C149* probably null Het
Other mutations in Mynn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Mynn APN 3 30613606 missense probably damaging 0.99
IGL01544:Mynn APN 3 30607705 nonsense probably null
IGL02084:Mynn APN 3 30611615 missense probably damaging 1.00
IGL02189:Mynn APN 3 30613544 splice site probably benign
IGL02261:Mynn APN 3 30607131 missense possibly damaging 0.67
IGL02541:Mynn APN 3 30611603 missense probably damaging 0.98
IGL02681:Mynn APN 3 30616642 missense probably benign 0.36
IGL03167:Mynn APN 3 30609042 missense probably damaging 1.00
PIT4494001:Mynn UTSW 3 30607722 nonsense probably null
R0049:Mynn UTSW 3 30607081 makesense probably null
R0321:Mynn UTSW 3 30607557 missense probably benign 0.01
R0420:Mynn UTSW 3 30607459 missense probably benign 0.42
R0574:Mynn UTSW 3 30616739 missense probably benign 0.01
R0576:Mynn UTSW 3 30607068 missense probably damaging 1.00
R1460:Mynn UTSW 3 30603704 missense probably damaging 0.99
R1882:Mynn UTSW 3 30616813 makesense probably null
R3115:Mynn UTSW 3 30607810 missense probably damaging 1.00
R4930:Mynn UTSW 3 30607042 missense probably damaging 1.00
R5153:Mynn UTSW 3 30611589 missense probably benign 0.00
R5351:Mynn UTSW 3 30607542 missense probably benign 0.01
R7446:Mynn UTSW 3 30607052 missense probably benign 0.01
R7468:Mynn UTSW 3 30603676 missense probably damaging 1.00
R7543:Mynn UTSW 3 30607039 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAGAGTTCCTCATTTGTGACATG -3'
(R):5'- GCTCCCTACATCTACTTTTAAACACAG -3'

Sequencing Primer
(F):5'- GCGTAATTTCACCCCAAATTGG -3'
(R):5'- GATCTAGTATCCAGTGTTGAAACGTG -3'
Posted On2015-02-18