Incidental Mutation 'R3442:Dbt'
ID267406
Institutional Source Beutler Lab
Gene Symbol Dbt
Ensembl Gene ENSMUSG00000000340
Gene Namedihydrolipoamide branched chain transacylase E2
SynonymsD3Wsu60e, dihydrolipoyllysine-residue (2-methylpropanoyl)transferase, dihydrolipoyl transacylase, BCKAD E2
MMRRC Submission 040660-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3442 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116513070-116549981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116548191 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 480 (D480E)
Ref Sequence ENSEMBL: ENSMUSP00000000349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000349]
Predicted Effect probably benign
Transcript: ENSMUST00000000349
AA Change: D480E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000349
Gene: ENSMUSG00000000340
AA Change: D480E

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 65 138 2.8e-22 PFAM
Pfam:E3_binding 171 206 4.4e-18 PFAM
low complexity region 218 232 N/A INTRINSIC
Pfam:2-oxoacid_dh 248 479 8.5e-83 PFAM
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid dehydrogenase complex (BCKD) is an inner-mitochondrial enzyme complex involved in the breakdown of the branched-chain amino acids isoleucine, leucine, and valine. The BCKD complex is thought to be composed of a core of 24 transacylase (E2) subunits, and associated decarboxylase (E1), dehydrogenase (E3), and regulatory subunits. This gene encodes the transacylase (E2) subunit. Mutations in this gene result in maple syrup urine disease, type 2. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, pallor, respiratory distress, and an increase in branched-chain amino acids in the blood and urine. Homozygotes model Maple Syrup Urine Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,656 Y26* probably null Het
Adam30 T C 3: 98,162,570 I573T probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Dmbt1 G A 7: 131,106,249 C1407Y probably damaging Het
Frem3 C T 8: 80,613,040 P654L probably damaging Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gpx1 C G 9: 108,339,350 T13S probably benign Het
Grik3 C A 4: 125,693,970 L628M probably damaging Het
Grik3 T A 4: 125,693,971 L628Q probably damaging Het
Gsap A G 5: 21,278,127 Y610C probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Msmb A G 14: 32,150,216 N55D probably benign Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Mynn T C 3: 30,613,563 F471L probably damaging Het
Olfr1501 T C 19: 13,839,006 T56A possibly damaging Het
Otof T C 5: 30,371,689 R1792G probably damaging Het
Sil1 A T 18: 35,325,396 L182H probably damaging Het
Sla C T 15: 66,783,660 G210D probably benign Het
Slc26a7 C T 4: 14,565,511 V191M probably benign Het
Trrap A G 5: 144,792,252 M659V probably benign Het
Ubxn6 G T 17: 56,069,049 Q371K probably benign Het
Zfat A T 15: 68,084,553 D1143E probably benign Het
Zfat C T 15: 68,101,581 A1122T probably damaging Het
Zfp950 A T 19: 61,118,732 C149* probably null Het
Other mutations in Dbt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Dbt APN 3 116539281 missense probably benign
IGL00660:Dbt APN 3 116546295 missense probably damaging 1.00
IGL00839:Dbt APN 3 116546114 missense probably benign 0.21
IGL00840:Dbt APN 3 116546114 missense probably benign 0.21
IGL00841:Dbt APN 3 116546114 missense probably benign 0.21
IGL00852:Dbt APN 3 116546114 missense probably benign 0.21
IGL00861:Dbt APN 3 116546114 missense probably benign 0.21
IGL00955:Dbt APN 3 116546114 missense probably benign 0.21
IGL00956:Dbt APN 3 116546114 missense probably benign 0.21
IGL01475:Dbt APN 3 116520259 missense possibly damaging 0.92
IGL01521:Dbt APN 3 116533383 missense probably benign 0.00
IGL01806:Dbt APN 3 116533305 missense probably damaging 1.00
IGL03288:Dbt APN 3 116548198 makesense probably null
R0025:Dbt UTSW 3 116534783 missense probably benign 0.22
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0066:Dbt UTSW 3 116543829 missense probably benign 0.00
R0190:Dbt UTSW 3 116539087 critical splice acceptor site probably null
R1650:Dbt UTSW 3 116534732 splice site probably null
R1750:Dbt UTSW 3 116546294 missense probably benign 0.18
R2130:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2131:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2133:Dbt UTSW 3 116539124 missense probably damaging 1.00
R2897:Dbt UTSW 3 116523412 missense probably damaging 1.00
R4241:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4681:Dbt UTSW 3 116533314 missense probably damaging 1.00
R4724:Dbt UTSW 3 116533296 missense probably damaging 1.00
R4736:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4737:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4738:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4740:Dbt UTSW 3 116539132 missense probably damaging 0.99
R4809:Dbt UTSW 3 116546343 missense probably damaging 1.00
R4823:Dbt UTSW 3 116523387 missense probably damaging 1.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R4861:Dbt UTSW 3 116548078 missense probably benign 0.00
R5148:Dbt UTSW 3 116528244 intron probably benign
R5327:Dbt UTSW 3 116528571 intron probably benign
R5700:Dbt UTSW 3 116520303 missense probably damaging 0.97
R5931:Dbt UTSW 3 116523425 missense possibly damaging 0.80
R6463:Dbt UTSW 3 116539760 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AAACCTCCTACCACTGTTGC -3'
(R):5'- GCAGAAAGCCCAATGTGTCAG -3'

Sequencing Primer
(F):5'- CTATGAGTGAGTGAAAGTTTACCC -3'
(R):5'- CCCAATGTGTCAGTGAGAAATACTG -3'
Posted On2015-02-18