Incidental Mutation 'R3442:Zfp950'
ID267435
Institutional Source Beutler Lab
Gene Symbol Zfp950
Ensembl Gene ENSMUSG00000074733
Gene Namezinc finger protein 950
SynonymsBC029127
MMRRC Submission 040660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3442 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location61053840-61140840 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 61118732 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 149 (C149*)
Predicted Effect probably null
Transcript: ENSMUST00000099260
AA Change: C149*
Predicted Effect probably benign
Transcript: ENSMUST00000122927
Predicted Effect probably benign
Transcript: ENSMUST00000127117
Predicted Effect probably benign
Transcript: ENSMUST00000127290
Predicted Effect probably benign
Transcript: ENSMUST00000143264
Predicted Effect probably benign
Transcript: ENSMUST00000178819
Predicted Effect probably benign
Transcript: ENSMUST00000180544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181469
Predicted Effect probably benign
Transcript: ENSMUST00000205712
Predicted Effect probably benign
Transcript: ENSMUST00000205854
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit some postnatal lethality, altered craniofacial structures, kidney defects, embryonic hemorrhaging and cell migration defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik T A 7: 12,512,656 Y26* probably null Het
Adam30 T C 3: 98,162,570 I573T probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cav3 G A 6: 112,472,441 C140Y possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Dbt T A 3: 116,548,191 D480E probably benign Het
Dmbt1 G A 7: 131,106,249 C1407Y probably damaging Het
Frem3 C T 8: 80,613,040 P654L probably damaging Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gpx1 C G 9: 108,339,350 T13S probably benign Het
Grik3 C A 4: 125,693,970 L628M probably damaging Het
Grik3 T A 4: 125,693,971 L628Q probably damaging Het
Gsap A G 5: 21,278,127 Y610C probably damaging Het
Gtf3c6 T A 10: 40,251,173 E123V probably null Het
Htr3b T C 9: 48,945,515 D221G probably benign Het
Maats1 T C 16: 38,333,806 M126V probably benign Het
Msmb A G 14: 32,150,216 N55D probably benign Het
Mx1 T A 16: 97,456,231 I109F probably damaging Het
Mynn T C 3: 30,613,563 F471L probably damaging Het
Olfr1501 T C 19: 13,839,006 T56A possibly damaging Het
Otof T C 5: 30,371,689 R1792G probably damaging Het
Sil1 A T 18: 35,325,396 L182H probably damaging Het
Sla C T 15: 66,783,660 G210D probably benign Het
Slc26a7 C T 4: 14,565,511 V191M probably benign Het
Trrap A G 5: 144,792,252 M659V probably benign Het
Ubxn6 G T 17: 56,069,049 Q371K probably benign Het
Zfat A T 15: 68,084,553 D1143E probably benign Het
Zfat C T 15: 68,101,581 A1122T probably damaging Het
Other mutations in Zfp950
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1892:Zfp950 UTSW 19 61119111 missense probably benign 0.05
R6062:Zfp950 UTSW 19 61120425 missense possibly damaging 0.89
R7231:Zfp950 UTSW 19 61119212 missense probably benign 0.28
R7285:Zfp950 UTSW 19 61119112 missense probably benign 0.02
R7399:Zfp950 UTSW 19 61119155 missense probably damaging 1.00
R7727:Zfp950 UTSW 19 61119941 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGTGTTGGATCTCAGTAAACCC -3'
(R):5'- ACATACTGGAGAGAAACCCTATG -3'

Sequencing Primer
(F):5'- GTTGGATCTCAGTAAACCCAATAAC -3'
(R):5'- GGAGAGAAACCCTATGAATTTAACC -3'
Posted On2015-02-18