Incidental Mutation 'R3508:Sox17'
ID267436
Institutional Source Beutler Lab
Gene Symbol Sox17
Ensembl Gene ENSMUSG00000025902
Gene NameSRY (sex determining region Y)-box 17
Synonyms
MMRRC Submission 040664-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3508 (G1)
Quality Score172
Status Not validated
Chromosome1
Chromosomal Location4490931-4497354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4492155 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 146 (P146Q)
Ref Sequence ENSEMBL: ENSMUSP00000141894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027035] [ENSMUST00000116652] [ENSMUST00000191647] [ENSMUST00000191939] [ENSMUST00000192650] [ENSMUST00000192913] [ENSMUST00000195555]
Predicted Effect probably damaging
Transcript: ENSMUST00000027035
AA Change: P274Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027035
Gene: ENSMUSG00000025902
AA Change: P274Q

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 417 9.5e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116652
AA Change: P274Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112351
Gene: ENSMUSG00000025902
AA Change: P274Q

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 330 9.8e-19 PFAM
Pfam:Sox_C_TAD 312 418 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191647
SMART Domains Protein: ENSMUSP00000142204
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 3.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191939
SMART Domains Protein: ENSMUSP00000142154
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192505
Predicted Effect probably benign
Transcript: ENSMUST00000192650
AA Change: P209Q

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142116
Gene: ENSMUSG00000025902
AA Change: P209Q

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 2.5e-7 PFAM
low complexity region 117 128 N/A INTRINSIC
Pfam:Sox_C_TAD 132 266 6.1e-16 PFAM
Pfam:Sox_C_TAD 255 353 4.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192913
SMART Domains Protein: ENSMUSP00000141674
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193450
Predicted Effect probably damaging
Transcript: ENSMUST00000195555
AA Change: P146Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141894
Gene: ENSMUSG00000025902
AA Change: P146Q

DomainStartEndE-ValueType
SCOP:d2lefa_ 1 21 6e-4 SMART
low complexity region 54 65 N/A INTRINSIC
Pfam:Sox_C_TAD 69 202 4.6e-16 PFAM
Pfam:Sox_C_TAD 192 290 3.1e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Sox (Sry-related high mobility group box) family of transcription factors involved in the regulation of embryonic development. The encoded protein plays a role in the determination of cell fate and in maintaining cell identity. This gene regulates tumor angiogenesis and tumor progression. Mutations in the human gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation develop a deficient gut endoderm and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,505 Y500* probably null Het
Abca8a A T 11: 110,063,165 F816L probably benign Het
Adgrl3 C A 5: 81,724,256 N932K probably damaging Het
Apol8 T C 15: 77,749,443 E311G probably damaging Het
Atad2b G A 12: 4,950,595 probably null Het
Carmil1 A G 13: 24,019,676 probably benign Het
Cdc20b T C 13: 113,081,042 S332P possibly damaging Het
Cep162 A G 9: 87,231,977 probably null Het
Cfap54 T A 10: 92,885,424 S2482C unknown Het
Cnpy1 T C 5: 28,207,367 E107G probably damaging Het
Crtac1 C T 19: 42,304,741 V310I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Elmo1 T C 13: 20,605,232 I706T probably damaging Het
F12 T C 13: 55,421,059 T297A probably benign Het
Fanci A G 7: 79,433,472 I736V probably benign Het
Fbn1 T C 2: 125,306,327 N2667S probably benign Het
Flt4 T C 11: 49,634,114 S596P probably damaging Het
Fndc1 G A 17: 7,765,108 R1329* probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
H2-M10.1 T G 17: 36,325,614 R99S possibly damaging Het
Homer3 T A 8: 70,291,355 V243D probably benign Het
Hspa14 A G 2: 3,491,008 S437P probably damaging Het
Inpp1 A T 1: 52,799,391 I33N probably damaging Het
Ipo5 T A 14: 120,939,544 Y714N probably damaging Het
Kif27 T C 13: 58,313,212 E898G possibly damaging Het
Klhdc7b T A 15: 89,386,892 M1K probably null Het
Krt83 A G 15: 101,488,158 Y241H probably benign Het
Mfsd4b1 A G 10: 40,002,719 I394T probably benign Het
Micall1 A G 15: 79,122,765 D264G probably damaging Het
Mms22l T G 4: 24,586,224 D905E probably benign Het
Musk A G 4: 58,327,347 D217G probably damaging Het
Napb T C 2: 148,698,960 T236A probably benign Het
Nbn T A 4: 15,962,387 D38E probably damaging Het
Ncaph T C 2: 127,127,193 N87D probably benign Het
Olfr1251 A G 2: 89,667,472 V138A probably benign Het
Pcdhb13 T A 18: 37,443,151 V194E probably damaging Het
Pck1 T C 2: 173,158,384 V536A possibly damaging Het
Pld5 C T 1: 175,994,037 G188S probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Pnkd A G 1: 74,350,634 T306A probably benign Het
Ppm1k T C 6: 57,514,990 E279G probably damaging Het
Ppm1l G T 3: 69,549,480 K243N possibly damaging Het
Ppp1r13b T C 12: 111,872,367 T26A probably damaging Het
Rtel1 T C 2: 181,322,409 V67A probably benign Het
Rxfp4 T C 3: 88,652,592 E184G probably damaging Het
Scp2d1 A G 2: 144,823,998 I86V probably benign Het
Sec16a G T 2: 26,425,850 P1718Q probably damaging Het
Sgcg T A 14: 61,221,746 T245S probably benign Het
Slc18a2 A G 19: 59,273,557 T215A probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sybu T A 15: 44,673,082 E616V probably damaging Het
Tk2 C T 8: 104,231,193 V174I probably benign Het
Tmc5 G A 7: 118,645,395 V499I probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tonsl T C 15: 76,639,756 T15A probably benign Het
Ttll12 A G 15: 83,580,630 I448T probably damaging Het
Ttn A G 2: 76,753,757 S22336P probably damaging Het
Ubap1 C A 4: 41,379,163 H126N probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vmn2r84 T C 10: 130,390,908 N354D probably damaging Het
Vpreb3 A C 10: 75,949,203 H45P probably benign Het
Zc3h13 T A 14: 75,308,940 Y160* probably null Het
Other mutations in Sox17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sox17 APN 1 4492203 missense possibly damaging 0.66
rheas UTSW 1 4492432 missense possibly damaging 0.71
R1160:Sox17 UTSW 1 4491852 missense probably damaging 1.00
R1503:Sox17 UTSW 1 4491928 missense probably damaging 1.00
R2911:Sox17 UTSW 1 4493131 missense probably damaging 1.00
R3004:Sox17 UTSW 1 4492617 missense probably damaging 1.00
R4596:Sox17 UTSW 1 4492637 missense possibly damaging 0.91
R5274:Sox17 UTSW 1 4491888 missense possibly damaging 0.74
R6544:Sox17 UTSW 1 4492432 missense possibly damaging 0.71
R7496:Sox17 UTSW 1 4492327 missense probably damaging 0.96
R7704:Sox17 UTSW 1 4493672
Z1088:Sox17 UTSW 1 4492302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGGATTCCGTGCCATC -3'
(R):5'- AAGTCTTGGAAGGCGTTGACC -3'

Sequencing Primer
(F):5'- AGGGGGCGAAGGTTGCC -3'
(R):5'- TGATGTCTCCGCACATGG -3'
Posted On2015-02-18