Mutagenetix > Incidental Mutation

Incidental Mutation 'R3508:Upf1'

267466

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

040664-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R3508 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70338460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 544 (R544H)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: R555H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: R555H

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: R544H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8963

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,505	Y500*	probably null	Het
Abca8a	A	T	11: 110,063,165	F816L	probably benign	Het
Adgrl3	C	A	5: 81,724,256	N932K	probably damaging	Het
Apol8	T	C	15: 77,749,443	E311G	probably damaging	Het
Atad2b	G	A	12: 4,950,595		probably null	Het
Carmil1	A	G	13: 24,019,676		probably benign	Het
Cdc20b	T	C	13: 113,081,042	S332P	possibly damaging	Het
Cep162	A	G	9: 87,231,977		probably null	Het
Cfap54	T	A	10: 92,885,424	S2482C	unknown	Het
Cnpy1	T	C	5: 28,207,367	E107G	probably damaging	Het
Crtac1	C	T	19: 42,304,741	V310I	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Elmo1	T	C	13: 20,605,232	I706T	probably damaging	Het
F12	T	C	13: 55,421,059	T297A	probably benign	Het
Fanci	A	G	7: 79,433,472	I736V	probably benign	Het
Fbn1	T	C	2: 125,306,327	N2667S	probably benign	Het
Flt4	T	C	11: 49,634,114	S596P	probably damaging	Het
Fndc1	G	A	17: 7,765,108	R1329*	probably null	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
H2-M10.1	T	G	17: 36,325,614	R99S	possibly damaging	Het
Homer3	T	A	8: 70,291,355	V243D	probably benign	Het
Hspa14	A	G	2: 3,491,008	S437P	probably damaging	Het
Inpp1	A	T	1: 52,799,391	I33N	probably damaging	Het
Ipo5	T	A	14: 120,939,544	Y714N	probably damaging	Het
Kif27	T	C	13: 58,313,212	E898G	possibly damaging	Het
Klhdc7b	T	A	15: 89,386,892	M1K	probably null	Het
Krt83	A	G	15: 101,488,158	Y241H	probably benign	Het
Mfsd4b1	A	G	10: 40,002,719	I394T	probably benign	Het
Micall1	A	G	15: 79,122,765	D264G	probably damaging	Het
Mms22l	T	G	4: 24,586,224	D905E	probably benign	Het
Musk	A	G	4: 58,327,347	D217G	probably damaging	Het
Napb	T	C	2: 148,698,960	T236A	probably benign	Het
Nbn	T	A	4: 15,962,387	D38E	probably damaging	Het
Ncaph	T	C	2: 127,127,193	N87D	probably benign	Het
Olfr1251	A	G	2: 89,667,472	V138A	probably benign	Het
Pcdhb13	T	A	18: 37,443,151	V194E	probably damaging	Het
Pck1	T	C	2: 173,158,384	V536A	possibly damaging	Het
Pld5	C	T	1: 175,994,037	G188S	probably damaging	Het
Plekha8	T	C	6: 54,613,194	V48A	probably damaging	Het
Pnkd	A	G	1: 74,350,634	T306A	probably benign	Het
Ppm1k	T	C	6: 57,514,990	E279G	probably damaging	Het
Ppm1l	G	T	3: 69,549,480	K243N	possibly damaging	Het
Ppp1r13b	T	C	12: 111,872,367	T26A	probably damaging	Het
Rtel1	T	C	2: 181,322,409	V67A	probably benign	Het
Rxfp4	T	C	3: 88,652,592	E184G	probably damaging	Het
Scp2d1	A	G	2: 144,823,998	I86V	probably benign	Het
Sec16a	G	T	2: 26,425,850	P1718Q	probably damaging	Het
Sgcg	T	A	14: 61,221,746	T245S	probably benign	Het
Slc18a2	A	G	19: 59,273,557	T215A	probably benign	Het
Sorcs1	G	A	19: 50,225,175	R705C	probably damaging	Het
Sox17	G	T	1: 4,492,155	P146Q	probably damaging	Het
Sybu	T	A	15: 44,673,082	E616V	probably damaging	Het
Tk2	C	T	8: 104,231,193	V174I	probably benign	Het
Tmc5	G	A	7: 118,645,395	V499I	probably benign	Het
Tmem110	C	T	14: 30,872,580	L217F	probably damaging	Het
Tonsl	T	C	15: 76,639,756	T15A	probably benign	Het
Ttll12	A	G	15: 83,580,630	I448T	probably damaging	Het
Ttn	A	G	2: 76,753,757	S22336P	probably damaging	Het
Ubap1	C	A	4: 41,379,163	H126N	probably damaging	Het
Vmn2r84	T	C	10: 130,390,908	N354D	probably damaging	Het
Vpreb3	A	C	10: 75,949,203	H45P	probably benign	Het
Zc3h13	T	A	14: 75,308,940	Y160*	probably null	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATCTGCAGATGACAGCTCGC -3'
(R):5'- CATGGCTGTACCTGCCTATTAC -3'

Sequencing Primer
(F):5'- GTCTCATCCTTTAGCTGCTGCAG -3'
(R):5'- TGCCTATTACAGCTGTGCAG -3'

Posted On

2015-02-18