Mutagenetix > Incidental Mutations

Incidental Mutation 'R3508:Kif27'

267479

Institutional Source

Beutler Lab

Gene Symbol

Kif27

Ensembl Gene

ENSMUSG00000060176

Gene Name

kinesin family member 27

Synonyms

4930517I18Rik

MMRRC Submission

040664-MU

Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R3508 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58287502-58359122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58313212 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 898 (E898G)

Ref Sequence

ENSEMBL: ENSMUSP00000153598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043605
AA Change: E898G

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: E898G

Domain	Start	End	E-Value	Type
KISc	3	349	9.18e-160	SMART
low complexity region	369	385	N/A	INTRINSIC
coiled coil region	386	418	N/A	INTRINSIC
Blast:KISc	486	566	5e-29	BLAST
coiled coil region	710	790	N/A	INTRINSIC
coiled coil region	835	891	N/A	INTRINSIC
coiled coil region	916	972	N/A	INTRINSIC
low complexity region	993	1008	N/A	INTRINSIC
coiled coil region	1010	1078	N/A	INTRINSIC
coiled coil region	1186	1226	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183772

Predicted Effect

probably benign
Transcript: ENSMUST00000224694

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225388
AA Change: E898G

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225680

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,505	Y500*	probably null	Het
Abca8a	A	T	11: 110,063,165	F816L	probably benign	Het
Adgrl3	C	A	5: 81,724,256	N932K	probably damaging	Het
Apol8	T	C	15: 77,749,443	E311G	probably damaging	Het
Atad2b	G	A	12: 4,950,595		probably null	Het
Carmil1	A	G	13: 24,019,676		probably benign	Het
Cdc20b	T	C	13: 113,081,042	S332P	possibly damaging	Het
Cep162	A	G	9: 87,231,977		probably null	Het
Cfap54	T	A	10: 92,885,424	S2482C	unknown	Het
Cnpy1	T	C	5: 28,207,367	E107G	probably damaging	Het
Crtac1	C	T	19: 42,304,741	V310I	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Elmo1	T	C	13: 20,605,232	I706T	probably damaging	Het
F12	T	C	13: 55,421,059	T297A	probably benign	Het
Fanci	A	G	7: 79,433,472	I736V	probably benign	Het
Fbn1	T	C	2: 125,306,327	N2667S	probably benign	Het
Flt4	T	C	11: 49,634,114	S596P	probably damaging	Het
Fndc1	G	A	17: 7,765,108	R1329*	probably null	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
H2-M10.1	T	G	17: 36,325,614	R99S	possibly damaging	Het
Homer3	T	A	8: 70,291,355	V243D	probably benign	Het
Hspa14	A	G	2: 3,491,008	S437P	probably damaging	Het
Inpp1	A	T	1: 52,799,391	I33N	probably damaging	Het
Ipo5	T	A	14: 120,939,544	Y714N	probably damaging	Het
Klhdc7b	T	A	15: 89,386,892	M1K	probably null	Het
Krt83	A	G	15: 101,488,158	Y241H	probably benign	Het
Mfsd4b1	A	G	10: 40,002,719	I394T	probably benign	Het
Micall1	A	G	15: 79,122,765	D264G	probably damaging	Het
Mms22l	T	G	4: 24,586,224	D905E	probably benign	Het
Musk	A	G	4: 58,327,347	D217G	probably damaging	Het
Napb	T	C	2: 148,698,960	T236A	probably benign	Het
Nbn	T	A	4: 15,962,387	D38E	probably damaging	Het
Ncaph	T	C	2: 127,127,193	N87D	probably benign	Het
Olfr1251	A	G	2: 89,667,472	V138A	probably benign	Het
Pcdhb13	T	A	18: 37,443,151	V194E	probably damaging	Het
Pck1	T	C	2: 173,158,384	V536A	possibly damaging	Het
Pld5	C	T	1: 175,994,037	G188S	probably damaging	Het
Plekha8	T	C	6: 54,613,194	V48A	probably damaging	Het
Pnkd	A	G	1: 74,350,634	T306A	probably benign	Het
Ppm1k	T	C	6: 57,514,990	E279G	probably damaging	Het
Ppm1l	G	T	3: 69,549,480	K243N	possibly damaging	Het
Ppp1r13b	T	C	12: 111,872,367	T26A	probably damaging	Het
Rtel1	T	C	2: 181,322,409	V67A	probably benign	Het
Rxfp4	T	C	3: 88,652,592	E184G	probably damaging	Het
Scp2d1	A	G	2: 144,823,998	I86V	probably benign	Het
Sec16a	G	T	2: 26,425,850	P1718Q	probably damaging	Het
Sgcg	T	A	14: 61,221,746	T245S	probably benign	Het
Slc18a2	A	G	19: 59,273,557	T215A	probably benign	Het
Sorcs1	G	A	19: 50,225,175	R705C	probably damaging	Het
Sox17	G	T	1: 4,492,155	P146Q	probably damaging	Het
Sybu	T	A	15: 44,673,082	E616V	probably damaging	Het
Tk2	C	T	8: 104,231,193	V174I	probably benign	Het
Tmc5	G	A	7: 118,645,395	V499I	probably benign	Het
Tmem110	C	T	14: 30,872,580	L217F	probably damaging	Het
Tonsl	T	C	15: 76,639,756	T15A	probably benign	Het
Ttll12	A	G	15: 83,580,630	I448T	probably damaging	Het
Ttn	A	G	2: 76,753,757	S22336P	probably damaging	Het
Ubap1	C	A	4: 41,379,163	H126N	probably damaging	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vmn2r84	T	C	10: 130,390,908	N354D	probably damaging	Het
Vpreb3	A	C	10: 75,949,203	H45P	probably benign	Het
Zc3h13	T	A	14: 75,308,940	Y160*	probably null	Het

Other mutations in Kif27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Kif27	APN	13	58337604	missense	probably benign
IGL00421:Kif27	APN	13	58343889	missense	probably damaging	1.00
IGL00903:Kif27	APN	13	58344672	missense	possibly damaging	0.69
IGL01024:Kif27	APN	13	58288201	missense	possibly damaging	0.71
IGL01070:Kif27	APN	13	58344093	missense	probably damaging	1.00
IGL01761:Kif27	APN	13	58337645	missense	probably benign
IGL02160:Kif27	APN	13	58325998	missense	probably damaging	1.00
IGL03162:Kif27	APN	13	58311207	missense	probably benign	0.03
P0016:Kif27	UTSW	13	58303452	nonsense	probably null
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0481:Kif27	UTSW	13	58311264	splice site	probably benign
R0960:Kif27	UTSW	13	58323967	missense	probably damaging	0.99
R1015:Kif27	UTSW	13	58320215	missense	probably damaging	1.00
R1205:Kif27	UTSW	13	58344205	missense	probably benign	0.00
R1478:Kif27	UTSW	13	58303545	missense	probably damaging	0.98
R1789:Kif27	UTSW	13	58344008	missense	probably damaging	1.00
R1959:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R1961:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R4168:Kif27	UTSW	13	58345748	missense	probably benign	0.01
R4247:Kif27	UTSW	13	58287917	missense	probably damaging	0.98
R4307:Kif27	UTSW	13	58344123	missense	probably benign	0.00
R4621:Kif27	UTSW	13	58331013	missense	probably benign	0.13
R4660:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4661:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4736:Kif27	UTSW	13	58328971	missense	probably benign	0.04
R4770:Kif27	UTSW	13	58344377	missense	probably damaging	1.00
R4853:Kif27	UTSW	13	58311258	missense	probably benign	0.06
R4963:Kif27	UTSW	13	58328994	missense	possibly damaging	0.85
R4998:Kif27	UTSW	13	58293143	missense	probably damaging	0.98
R5134:Kif27	UTSW	13	58291090	missense	possibly damaging	0.80
R5225:Kif27	UTSW	13	58293101	missense	possibly damaging	0.88
R5835:Kif27	UTSW	13	58313146	critical splice donor site	probably null
R5875:Kif27	UTSW	13	58311104	missense	probably benign	0.01
R5929:Kif27	UTSW	13	58343970	missense	probably benign	0.01
R6175:Kif27	UTSW	13	58311237	missense	probably damaging	1.00
R6446:Kif27	UTSW	13	58345716	missense	probably damaging	1.00
R6628:Kif27	UTSW	13	58354797	missense	probably damaging	1.00
R7480:Kif27	UTSW	13	58288211	missense	probably benign	0.34
R8381:Kif27	UTSW	13	58291177	missense	probably benign	0.00
Z1088:Kif27	UTSW	13	58288033	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCATGCCTGCCAACATAGAAAG -3'
(R):5'- TGGGGTCTAACCTAGCACAGATAAG -3'

Sequencing Primer
(F):5'- CCCTGTACTGGGGCATATGATC -3'
(R):5'- TCTAACCTAGCACAGATAAGGAAAG -3'

Posted On

2015-02-18