Mutagenetix > Incidental Mutations

Incidental Mutation 'R3508:Sybu'

267486

Institutional Source

Beutler Lab

Gene Symbol

Sybu

Ensembl Gene

ENSMUSG00000022340

Gene Name

syntabulin (syntaxin-interacting)

Synonyms

A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik

MMRRC Submission

040664-MU

Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R3508 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44671856-44788063 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44673082 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 616 (E616V)

Ref Sequence

ENSEMBL: ENSMUSP00000087511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]

Predicted Effect

probably damaging
Transcript: ENSMUST00000090057
AA Change: E616V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: E616V

Domain	Start	End	E-Value	Type
low complexity region	51	61	N/A	INTRINSIC
low complexity region	112	120	N/A	INTRINSIC
low complexity region	148	163	N/A	INTRINSIC
low complexity region	174	205	N/A	INTRINSIC
low complexity region	264	275	N/A	INTRINSIC
low complexity region	276	290	N/A	INTRINSIC
low complexity region	320	331	N/A	INTRINSIC
Pfam:Syntaphilin	343	638	3.5e-142	PFAM
low complexity region	738	755	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110267
AA Change: E488V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: E488V

Domain	Start	End	E-Value	Type
low complexity region	20	35	N/A	INTRINSIC
low complexity region	46	77	N/A	INTRINSIC
low complexity region	136	147	N/A	INTRINSIC
low complexity region	148	162	N/A	INTRINSIC
low complexity region	192	203	N/A	INTRINSIC
Pfam:Syntaphilin	214	511	5.8e-140	PFAM
low complexity region	610	627	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110269
AA Change: E416V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: E416V

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
low complexity region	76	90	N/A	INTRINSIC
low complexity region	120	131	N/A	INTRINSIC
Pfam:Syntaphilin	142	439	4.4e-140	PFAM
low complexity region	538	555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226825

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227081

Predicted Effect

probably damaging
Transcript: ENSMUST00000227305
AA Change: E487V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000228057
AA Change: E488V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,505	Y500*	probably null	Het
Abca8a	A	T	11: 110,063,165	F816L	probably benign	Het
Adgrl3	C	A	5: 81,724,256	N932K	probably damaging	Het
Apol8	T	C	15: 77,749,443	E311G	probably damaging	Het
Atad2b	G	A	12: 4,950,595		probably null	Het
Carmil1	A	G	13: 24,019,676		probably benign	Het
Cdc20b	T	C	13: 113,081,042	S332P	possibly damaging	Het
Cep162	A	G	9: 87,231,977		probably null	Het
Cfap54	T	A	10: 92,885,424	S2482C	unknown	Het
Cnpy1	T	C	5: 28,207,367	E107G	probably damaging	Het
Crtac1	C	T	19: 42,304,741	V310I	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Elmo1	T	C	13: 20,605,232	I706T	probably damaging	Het
F12	T	C	13: 55,421,059	T297A	probably benign	Het
Fanci	A	G	7: 79,433,472	I736V	probably benign	Het
Fbn1	T	C	2: 125,306,327	N2667S	probably benign	Het
Flt4	T	C	11: 49,634,114	S596P	probably damaging	Het
Fndc1	G	A	17: 7,765,108	R1329*	probably null	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
H2-M10.1	T	G	17: 36,325,614	R99S	possibly damaging	Het
Homer3	T	A	8: 70,291,355	V243D	probably benign	Het
Hspa14	A	G	2: 3,491,008	S437P	probably damaging	Het
Inpp1	A	T	1: 52,799,391	I33N	probably damaging	Het
Ipo5	T	A	14: 120,939,544	Y714N	probably damaging	Het
Kif27	T	C	13: 58,313,212	E898G	possibly damaging	Het
Klhdc7b	T	A	15: 89,386,892	M1K	probably null	Het
Krt83	A	G	15: 101,488,158	Y241H	probably benign	Het
Mfsd4b1	A	G	10: 40,002,719	I394T	probably benign	Het
Micall1	A	G	15: 79,122,765	D264G	probably damaging	Het
Mms22l	T	G	4: 24,586,224	D905E	probably benign	Het
Musk	A	G	4: 58,327,347	D217G	probably damaging	Het
Napb	T	C	2: 148,698,960	T236A	probably benign	Het
Nbn	T	A	4: 15,962,387	D38E	probably damaging	Het
Ncaph	T	C	2: 127,127,193	N87D	probably benign	Het
Olfr1251	A	G	2: 89,667,472	V138A	probably benign	Het
Pcdhb13	T	A	18: 37,443,151	V194E	probably damaging	Het
Pck1	T	C	2: 173,158,384	V536A	possibly damaging	Het
Pld5	C	T	1: 175,994,037	G188S	probably damaging	Het
Plekha8	T	C	6: 54,613,194	V48A	probably damaging	Het
Pnkd	A	G	1: 74,350,634	T306A	probably benign	Het
Ppm1k	T	C	6: 57,514,990	E279G	probably damaging	Het
Ppm1l	G	T	3: 69,549,480	K243N	possibly damaging	Het
Ppp1r13b	T	C	12: 111,872,367	T26A	probably damaging	Het
Rtel1	T	C	2: 181,322,409	V67A	probably benign	Het
Rxfp4	T	C	3: 88,652,592	E184G	probably damaging	Het
Scp2d1	A	G	2: 144,823,998	I86V	probably benign	Het
Sec16a	G	T	2: 26,425,850	P1718Q	probably damaging	Het
Sgcg	T	A	14: 61,221,746	T245S	probably benign	Het
Slc18a2	A	G	19: 59,273,557	T215A	probably benign	Het
Sorcs1	G	A	19: 50,225,175	R705C	probably damaging	Het
Sox17	G	T	1: 4,492,155	P146Q	probably damaging	Het
Tk2	C	T	8: 104,231,193	V174I	probably benign	Het
Tmc5	G	A	7: 118,645,395	V499I	probably benign	Het
Tmem110	C	T	14: 30,872,580	L217F	probably damaging	Het
Tonsl	T	C	15: 76,639,756	T15A	probably benign	Het
Ttll12	A	G	15: 83,580,630	I448T	probably damaging	Het
Ttn	A	G	2: 76,753,757	S22336P	probably damaging	Het
Ubap1	C	A	4: 41,379,163	H126N	probably damaging	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vmn2r84	T	C	10: 130,390,908	N354D	probably damaging	Het
Vpreb3	A	C	10: 75,949,203	H45P	probably benign	Het
Zc3h13	T	A	14: 75,308,940	Y160*	probably null	Het

Other mutations in Sybu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01453:Sybu	APN	15	44672805	missense	probably damaging	1.00
IGL02211:Sybu	APN	15	44673466	missense	probably damaging	1.00
IGL02303:Sybu	APN	15	44673223	missense	probably benign	0.03
E7848:Sybu	UTSW	15	44673422	missense	probably benign	0.32
R0015:Sybu	UTSW	15	44673500	missense	probably damaging	0.99
R0015:Sybu	UTSW	15	44673500	missense	probably damaging	0.99
R0064:Sybu	UTSW	15	44672993	missense	probably benign	0.00
R0064:Sybu	UTSW	15	44672993	missense	probably benign	0.00
R0413:Sybu	UTSW	15	44673272	missense	probably damaging	1.00
R0650:Sybu	UTSW	15	44673268	missense	probably benign	0.08
R1147:Sybu	UTSW	15	44746255	missense	probably damaging	1.00
R1147:Sybu	UTSW	15	44746255	missense	probably damaging	1.00
R1307:Sybu	UTSW	15	44675390	missense	probably damaging	1.00
R1568:Sybu	UTSW	15	44718832	nonsense	probably null
R2112:Sybu	UTSW	15	44673335	missense	probably benign	0.06
R2967:Sybu	UTSW	15	44746356	missense	probably damaging	1.00
R3120:Sybu	UTSW	15	44672959	missense	possibly damaging	0.88
R3429:Sybu	UTSW	15	44746458	missense	probably damaging	0.98
R3720:Sybu	UTSW	15	44672632	missense	possibly damaging	0.89
R4080:Sybu	UTSW	15	44718943	missense	probably damaging	1.00
R4898:Sybu	UTSW	15	44675499	missense	probably benign	0.02
R4975:Sybu	UTSW	15	44677667	missense	probably damaging	1.00
R5066:Sybu	UTSW	15	44677644	missense	probably damaging	1.00
R5783:Sybu	UTSW	15	44746414	missense	probably damaging	0.96
R5913:Sybu	UTSW	15	44787621	missense	probably damaging	1.00
R6977:Sybu	UTSW	15	44677695	missense	probably benign	0.00
R7044:Sybu	UTSW	15	44677695	missense	possibly damaging	0.79
R7139:Sybu	UTSW	15	44677714	missense	possibly damaging	0.93
R7328:Sybu	UTSW	15	44787794	missense	not run
R7543:Sybu	UTSW	15	44683452	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCCTTGCTGAATGGGATCTC -3'
(R):5'- TGCTGACAGTGAGCTTCTG -3'

Sequencing Primer
(F):5'- GGACTTCTTGGAGTTAAATCAAGC -3'
(R):5'- AGCTTCTGGTGGGAGACAG -3'

Posted On

2015-02-18