Mutagenetix > Incidental Mutations

Incidental Mutation 'R3508:Crtac1'

267499

Institutional Source

Beutler Lab

Gene Symbol

Crtac1

Ensembl Gene

ENSMUSG00000042401

Gene Name

cartilage acidic protein 1

Synonyms

Lotus, Crtac1B, 2810454P21Rik

MMRRC Submission

040664-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.411) question?

Stock #

R3508 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

42283037-42431783 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 42304741 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 310 (V310I)

Ref Sequence

ENSEMBL: ENSMUSP00000044858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048630]

Predicted Effect

probably benign
Transcript: ENSMUST00000048630
AA Change: V310I

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000044858
Gene: ENSMUSG00000042401
AA Change: V310I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:VCBS	63	133	6.6e-12	PFAM
Pfam:VCBS	254	311	2e-12	PFAM
Pfam:VCBS	300	364	4.9e-13	PFAM
low complexity region	403	417	N/A	INTRINSIC
Pfam:UnbV_ASPIC	459	528	8.9e-18	PFAM
Pfam:EGF_CA	560	606	2.1e-13	PFAM
low complexity region	630	646	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in lateral olfactory tract morphology and axon fasciculation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	A	T	13: 59,742,505	Y500*	probably null	Het
Abca8a	A	T	11: 110,063,165	F816L	probably benign	Het
Adgrl3	C	A	5: 81,724,256	N932K	probably damaging	Het
Apol8	T	C	15: 77,749,443	E311G	probably damaging	Het
Atad2b	G	A	12: 4,950,595		probably null	Het
Carmil1	A	G	13: 24,019,676		probably benign	Het
Cdc20b	T	C	13: 113,081,042	S332P	possibly damaging	Het
Cep162	A	G	9: 87,231,977		probably null	Het
Cfap54	T	A	10: 92,885,424	S2482C	unknown	Het
Cnpy1	T	C	5: 28,207,367	E107G	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Elmo1	T	C	13: 20,605,232	I706T	probably damaging	Het
F12	T	C	13: 55,421,059	T297A	probably benign	Het
Fanci	A	G	7: 79,433,472	I736V	probably benign	Het
Fbn1	T	C	2: 125,306,327	N2667S	probably benign	Het
Flt4	T	C	11: 49,634,114	S596P	probably damaging	Het
Fndc1	G	A	17: 7,765,108	R1329*	probably null	Het
Gjd4	G	T	18: 9,280,811	S89*	probably null	Het
H2-M10.1	T	G	17: 36,325,614	R99S	possibly damaging	Het
Homer3	T	A	8: 70,291,355	V243D	probably benign	Het
Hspa14	A	G	2: 3,491,008	S437P	probably damaging	Het
Inpp1	A	T	1: 52,799,391	I33N	probably damaging	Het
Ipo5	T	A	14: 120,939,544	Y714N	probably damaging	Het
Kif27	T	C	13: 58,313,212	E898G	possibly damaging	Het
Klhdc7b	T	A	15: 89,386,892	M1K	probably null	Het
Krt83	A	G	15: 101,488,158	Y241H	probably benign	Het
Mfsd4b1	A	G	10: 40,002,719	I394T	probably benign	Het
Micall1	A	G	15: 79,122,765	D264G	probably damaging	Het
Mms22l	T	G	4: 24,586,224	D905E	probably benign	Het
Musk	A	G	4: 58,327,347	D217G	probably damaging	Het
Napb	T	C	2: 148,698,960	T236A	probably benign	Het
Nbn	T	A	4: 15,962,387	D38E	probably damaging	Het
Ncaph	T	C	2: 127,127,193	N87D	probably benign	Het
Olfr1251	A	G	2: 89,667,472	V138A	probably benign	Het
Pcdhb13	T	A	18: 37,443,151	V194E	probably damaging	Het
Pck1	T	C	2: 173,158,384	V536A	possibly damaging	Het
Pld5	C	T	1: 175,994,037	G188S	probably damaging	Het
Plekha8	T	C	6: 54,613,194	V48A	probably damaging	Het
Pnkd	A	G	1: 74,350,634	T306A	probably benign	Het
Ppm1k	T	C	6: 57,514,990	E279G	probably damaging	Het
Ppm1l	G	T	3: 69,549,480	K243N	possibly damaging	Het
Ppp1r13b	T	C	12: 111,872,367	T26A	probably damaging	Het
Rtel1	T	C	2: 181,322,409	V67A	probably benign	Het
Rxfp4	T	C	3: 88,652,592	E184G	probably damaging	Het
Scp2d1	A	G	2: 144,823,998	I86V	probably benign	Het
Sec16a	G	T	2: 26,425,850	P1718Q	probably damaging	Het
Sgcg	T	A	14: 61,221,746	T245S	probably benign	Het
Slc18a2	A	G	19: 59,273,557	T215A	probably benign	Het
Sorcs1	G	A	19: 50,225,175	R705C	probably damaging	Het
Sox17	G	T	1: 4,492,155	P146Q	probably damaging	Het
Sybu	T	A	15: 44,673,082	E616V	probably damaging	Het
Tk2	C	T	8: 104,231,193	V174I	probably benign	Het
Tmc5	G	A	7: 118,645,395	V499I	probably benign	Het
Tmem110	C	T	14: 30,872,580	L217F	probably damaging	Het
Tonsl	T	C	15: 76,639,756	T15A	probably benign	Het
Ttll12	A	G	15: 83,580,630	I448T	probably damaging	Het
Ttn	A	G	2: 76,753,757	S22336P	probably damaging	Het
Ubap1	C	A	4: 41,379,163	H126N	probably damaging	Het
Upf1	C	T	8: 70,338,460	R544H	probably damaging	Het
Vmn2r84	T	C	10: 130,390,908	N354D	probably damaging	Het
Vpreb3	A	C	10: 75,949,203	H45P	probably benign	Het
Zc3h13	T	A	14: 75,308,940	Y160*	probably null	Het

Other mutations in Crtac1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Crtac1	APN	19	42323794	missense	probably damaging	1.00
IGL01296:Crtac1	APN	19	42284213	missense	probably damaging	1.00
IGL01991:Crtac1	APN	19	42414121	missense	possibly damaging	0.96
IGL02811:Crtac1	APN	19	42333911	missense	probably damaging	1.00
R1957:Crtac1	UTSW	19	42287944	missense	possibly damaging	0.79
R2046:Crtac1	UTSW	19	42334053	missense	probably damaging	1.00
R2125:Crtac1	UTSW	19	42323732	missense	probably damaging	1.00
R2280:Crtac1	UTSW	19	42283567	missense	unknown
R2281:Crtac1	UTSW	19	42283567	missense	unknown
R3923:Crtac1	UTSW	19	42333947	missense	probably damaging	1.00
R4072:Crtac1	UTSW	19	42304707	missense	probably damaging	1.00
R4798:Crtac1	UTSW	19	42323801	missense	possibly damaging	0.93
R4951:Crtac1	UTSW	19	42414131	missense	probably benign
R4965:Crtac1	UTSW	19	42318740	missense	probably damaging	1.00
R5190:Crtac1	UTSW	19	42333908	missense	possibly damaging	0.50
R5579:Crtac1	UTSW	19	42304806	missense	probably damaging	1.00
R5595:Crtac1	UTSW	19	42413951	missense	probably benign	0.08
R5739:Crtac1	UTSW	19	42302173	missense	probably damaging	1.00
R5872:Crtac1	UTSW	19	42309190	splice site	probably null
R5936:Crtac1	UTSW	19	42323837	missense	probably damaging	1.00
R6149:Crtac1	UTSW	19	42283609	missense	unknown
R6193:Crtac1	UTSW	19	42323797	missense	possibly damaging	0.47
R6858:Crtac1	UTSW	19	42318735	missense	possibly damaging	0.93
R7246:Crtac1	UTSW	19	42287926	missense	probably benign
R7726:Crtac1	UTSW	19	42302251	nonsense	probably null
R7991:Crtac1	UTSW	19	42333960	missense	probably benign	0.24
R8046:Crtac1	UTSW	19	42309053	splice site	probably benign
R8071:Crtac1	UTSW	19	42297800	missense	probably damaging	1.00
R8350:Crtac1	UTSW	19	42309186	missense	probably damaging	1.00
R8450:Crtac1	UTSW	19	42309186	missense	probably damaging	1.00
X0018:Crtac1	UTSW	19	42309114	missense	probably damaging	1.00
Z1176:Crtac1	UTSW	19	42287926	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAACTCCAAGGTCTCCTGG -3'
(R):5'- TGCCCCTATGAGAACATCTAAGATG -3'

Sequencing Primer
(F):5'- CAAGGTCTCCTGGGCTTATCAG -3'
(R):5'- TCTTCCTGGGAAAACAAGAACTG -3'

Posted On

2015-02-18