Incidental Mutation 'R3508:Slc18a2'
ID267501
Institutional Source Beutler Lab
Gene Symbol Slc18a2
Ensembl Gene ENSMUSG00000025094
Gene Namesolute carrier family 18 (vesicular monoamine), member 2
SynonymsVmat2, 1110037L13Rik
MMRRC Submission 040664-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3508 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location59260878-59296012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59273557 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 215 (T215A)
Ref Sequence ENSEMBL: ENSMUSP00000026084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084]
Predicted Effect probably benign
Transcript: ENSMUST00000026084
AA Change: T215A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094
AA Change: T215A

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into synaptic vesicles, using the proton gradient maintained across the synaptic vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (summary by Peter et al., 1993 [PubMed 7905859]). See also SLC18A1 (MIM 193002).[supplied by OMIM, Jan 2011]
PHENOTYPE: Nullizygous mice exhibit early postnatal death accompanied by reduced body size, hypokinesia, and reduced brain monoamine levels. Hypomorphic mutants show impaired olfaction, gastroparesis, altered sleep latency, neuron degeneration, enhanced MPTP sensitivity, anxiety- and depressive-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,742,505 Y500* probably null Het
Abca8a A T 11: 110,063,165 F816L probably benign Het
Adgrl3 C A 5: 81,724,256 N932K probably damaging Het
Apol8 T C 15: 77,749,443 E311G probably damaging Het
Atad2b G A 12: 4,950,595 probably null Het
Carmil1 A G 13: 24,019,676 probably benign Het
Cdc20b T C 13: 113,081,042 S332P possibly damaging Het
Cep162 A G 9: 87,231,977 probably null Het
Cfap54 T A 10: 92,885,424 S2482C unknown Het
Cnpy1 T C 5: 28,207,367 E107G probably damaging Het
Crtac1 C T 19: 42,304,741 V310I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Elmo1 T C 13: 20,605,232 I706T probably damaging Het
F12 T C 13: 55,421,059 T297A probably benign Het
Fanci A G 7: 79,433,472 I736V probably benign Het
Fbn1 T C 2: 125,306,327 N2667S probably benign Het
Flt4 T C 11: 49,634,114 S596P probably damaging Het
Fndc1 G A 17: 7,765,108 R1329* probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
H2-M10.1 T G 17: 36,325,614 R99S possibly damaging Het
Homer3 T A 8: 70,291,355 V243D probably benign Het
Hspa14 A G 2: 3,491,008 S437P probably damaging Het
Inpp1 A T 1: 52,799,391 I33N probably damaging Het
Ipo5 T A 14: 120,939,544 Y714N probably damaging Het
Kif27 T C 13: 58,313,212 E898G possibly damaging Het
Klhdc7b T A 15: 89,386,892 M1K probably null Het
Krt83 A G 15: 101,488,158 Y241H probably benign Het
Mfsd4b1 A G 10: 40,002,719 I394T probably benign Het
Micall1 A G 15: 79,122,765 D264G probably damaging Het
Mms22l T G 4: 24,586,224 D905E probably benign Het
Musk A G 4: 58,327,347 D217G probably damaging Het
Napb T C 2: 148,698,960 T236A probably benign Het
Nbn T A 4: 15,962,387 D38E probably damaging Het
Ncaph T C 2: 127,127,193 N87D probably benign Het
Olfr1251 A G 2: 89,667,472 V138A probably benign Het
Pcdhb13 T A 18: 37,443,151 V194E probably damaging Het
Pck1 T C 2: 173,158,384 V536A possibly damaging Het
Pld5 C T 1: 175,994,037 G188S probably damaging Het
Plekha8 T C 6: 54,613,194 V48A probably damaging Het
Pnkd A G 1: 74,350,634 T306A probably benign Het
Ppm1k T C 6: 57,514,990 E279G probably damaging Het
Ppm1l G T 3: 69,549,480 K243N possibly damaging Het
Ppp1r13b T C 12: 111,872,367 T26A probably damaging Het
Rtel1 T C 2: 181,322,409 V67A probably benign Het
Rxfp4 T C 3: 88,652,592 E184G probably damaging Het
Scp2d1 A G 2: 144,823,998 I86V probably benign Het
Sec16a G T 2: 26,425,850 P1718Q probably damaging Het
Sgcg T A 14: 61,221,746 T245S probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sox17 G T 1: 4,492,155 P146Q probably damaging Het
Sybu T A 15: 44,673,082 E616V probably damaging Het
Tk2 C T 8: 104,231,193 V174I probably benign Het
Tmc5 G A 7: 118,645,395 V499I probably benign Het
Tmem110 C T 14: 30,872,580 L217F probably damaging Het
Tonsl T C 15: 76,639,756 T15A probably benign Het
Ttll12 A G 15: 83,580,630 I448T probably damaging Het
Ttn A G 2: 76,753,757 S22336P probably damaging Het
Ubap1 C A 4: 41,379,163 H126N probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vmn2r84 T C 10: 130,390,908 N354D probably damaging Het
Vpreb3 A C 10: 75,949,203 H45P probably benign Het
Zc3h13 T A 14: 75,308,940 Y160* probably null Het
Other mutations in Slc18a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Slc18a2 APN 19 59284384 missense probably benign 0.02
IGL01956:Slc18a2 APN 19 59287176 splice site probably benign
IGL02220:Slc18a2 APN 19 59276556 missense probably benign 0.01
IGL02389:Slc18a2 APN 19 59263301 splice site probably benign
IGL02795:Slc18a2 APN 19 59274490 splice site probably benign
PIT4585001:Slc18a2 UTSW 19 59293861 missense possibly damaging 0.47
R0373:Slc18a2 UTSW 19 59287367 missense probably benign
R1972:Slc18a2 UTSW 19 59274653 missense possibly damaging 0.89
R2018:Slc18a2 UTSW 19 59276505 missense possibly damaging 0.90
R5313:Slc18a2 UTSW 19 59293843 missense probably benign 0.04
R5574:Slc18a2 UTSW 19 59261405 missense probably benign 0.09
R6102:Slc18a2 UTSW 19 59293878 missense probably benign 0.00
R7569:Slc18a2 UTSW 19 59284152 missense probably damaging 0.96
R7607:Slc18a2 UTSW 19 59284358 missense probably benign 0.43
R7818:Slc18a2 UTSW 19 59263161 missense probably benign
R8059:Slc18a2 UTSW 19 59284140 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TACTGATGCAGGGACCAGAG -3'
(R):5'- TTTCCCAAAAGCTCCATGGG -3'

Sequencing Primer
(F):5'- TGCAGGGACCAGAGGTAGATG -3'
(R):5'- CAGAGAGGAGGGCTGGATGTC -3'
Posted On2015-02-18