Incidental Mutation 'R3522:Mdh1b'
ID 267504
Institutional Source Beutler Lab
Gene Symbol Mdh1b
Ensembl Gene ENSMUSG00000025963
Gene Name malate dehydrogenase 1B, NAD (soluble)
Synonyms 1700124B08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63698819-63730318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63719768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 222 (V222M)
Ref Sequence ENSEMBL: ENSMUSP00000109728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114094]
AlphaFold Q5F204
Predicted Effect probably damaging
Transcript: ENSMUST00000114094
AA Change: V222M

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109728
Gene: ENSMUSG00000025963
AA Change: V222M

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
SCOP:d1b8pa1 131 282 1e-16 SMART
PDB:5MDH|B 131 457 3e-32 PDB
SCOP:d7mdha2 290 454 7e-18 SMART
Meta Mutation Damage Score 0.2435 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Mdh1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Mdh1b APN 1 63711106 splice site probably benign
IGL02314:Mdh1b APN 1 63711114 critical splice donor site probably null
IGL02390:Mdh1b APN 1 63721557 missense probably benign 0.27
IGL02582:Mdh1b APN 1 63719597 missense probably benign 0.08
IGL02864:Mdh1b APN 1 63721603 missense probably benign 0.00
IGL02887:Mdh1b APN 1 63715364 splice site probably benign
IGL03073:Mdh1b APN 1 63721487 critical splice donor site probably null
IGL03372:Mdh1b APN 1 63719995 missense possibly damaging 0.64
IGL02835:Mdh1b UTSW 1 63718657 missense probably damaging 1.00
R0015:Mdh1b UTSW 1 63721800 splice site probably benign
R0015:Mdh1b UTSW 1 63721800 splice site probably benign
R0255:Mdh1b UTSW 1 63719618 missense probably damaging 1.00
R1750:Mdh1b UTSW 1 63719522 missense probably benign
R2057:Mdh1b UTSW 1 63721582 missense probably benign 0.11
R3177:Mdh1b UTSW 1 63711531 missense possibly damaging 0.93
R3277:Mdh1b UTSW 1 63711531 missense possibly damaging 0.93
R4938:Mdh1b UTSW 1 63711504 missense probably benign 0.00
R4967:Mdh1b UTSW 1 63719863 missense probably damaging 1.00
R5093:Mdh1b UTSW 1 63711461 missense probably benign 0.08
R5160:Mdh1b UTSW 1 63725645 missense probably null 0.01
R5311:Mdh1b UTSW 1 63720004 missense probably benign 0.00
R6345:Mdh1b UTSW 1 63715239 missense possibly damaging 0.52
R6974:Mdh1b UTSW 1 63721816 missense probably benign 0.00
R7073:Mdh1b UTSW 1 63721560 missense probably damaging 1.00
R7728:Mdh1b UTSW 1 63715270 missense probably benign 0.23
R7780:Mdh1b UTSW 1 63719974 missense possibly damaging 0.76
R8271:Mdh1b UTSW 1 63720005 missense possibly damaging 0.62
R8556:Mdh1b UTSW 1 63710982 splice site probably null
R8681:Mdh1b UTSW 1 63715201 missense probably benign
Z1176:Mdh1b UTSW 1 63711531 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGCCACTGCGATAATGTTG -3'
(R):5'- TCTTGCTAAGCGGGGAAGTG -3'

Sequencing Primer
(F):5'- ACTGCGATAATGTTGCTCGC -3'
(R):5'- AGAGATCAGCCTGACCCTGTTTG -3'
Posted On 2015-02-18