Incidental Mutation 'R3522:Sec61a2'
ID 267506
Institutional Source Beutler Lab
Gene Symbol Sec61a2
Ensembl Gene ENSMUSG00000025816
Gene Name SEC61 translocon subunit alpha 2
Synonyms
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.293) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 5875798-5900243 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5898027 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 5 (F5L)
Ref Sequence ENSEMBL: ENSMUSP00000141333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026924] [ENSMUST00000026926] [ENSMUST00000095147] [ENSMUST00000102981] [ENSMUST00000193792]
AlphaFold Q9JLR1
Predicted Effect probably benign
Transcript: ENSMUST00000026924
SMART Domains Protein: ENSMUSP00000026924
Gene: ENSMUSG00000025815

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000026926
AA Change: F5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026926
Gene: ENSMUSG00000025816
AA Change: F5L

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.9e-24 PFAM
Pfam:SecY 75 162 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095147
SMART Domains Protein: ENSMUSP00000092769
Gene: ENSMUSG00000025815

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000102981
AA Change: F5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100046
Gene: ENSMUSG00000025816
AA Change: F5L

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.2e-21 PFAM
Pfam:SecY 75 458 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150099
Predicted Effect probably benign
Transcript: ENSMUST00000193792
AA Change: F5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141333
Gene: ENSMUSG00000025816
AA Change: F5L

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 4e-22 PFAM
Pfam:SecY 75 263 5.3e-44 PFAM
Pfam:SecY 261 393 1.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194565
Meta Mutation Damage Score 0.2352 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to a mouse protein which suggests a role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. It may also be required for the assembly of membrane and secretory proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,592,378 (GRCm39) E888G probably damaging Het
Arhgef10 T C 8: 15,004,918 (GRCm39) F150S probably damaging Het
Atp10d G T 5: 72,396,500 (GRCm39) R235L probably benign Het
Cacna1b A G 2: 24,653,055 (GRCm39) V2A possibly damaging Het
Cand1 A T 10: 119,075,102 (GRCm39) L15Q probably benign Het
Cavin3 C A 7: 105,130,350 (GRCm39) G154V probably benign Het
Ccdc73 A T 2: 104,821,830 (GRCm39) D593V probably damaging Het
Cdk5rap2 T C 4: 70,168,647 (GRCm39) K161E probably damaging Het
Chil4 A T 3: 106,111,056 (GRCm39) N279K probably benign Het
Chst13 T G 6: 90,295,245 (GRCm39) D56A probably damaging Het
Cnn1 C A 9: 22,010,664 (GRCm39) H5N probably benign Het
Cpsf4l T A 11: 113,593,319 (GRCm39) K88N probably damaging Het
Ctnnbl1 G T 2: 157,713,113 (GRCm39) probably null Het
Dnah7a A C 1: 53,657,275 (GRCm39) F834V probably damaging Het
Fbxo41 A G 6: 85,461,163 (GRCm39) S182P probably benign Het
Fkbp5 T C 17: 28,634,970 (GRCm39) T180A probably benign Het
Flg2 T A 3: 93,127,334 (GRCm39) I2082N unknown Het
Gm4968 A G 6: 127,210,725 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 116,761,747 (GRCm39) H612Q probably benign Het
Gsg1 A T 6: 135,218,251 (GRCm39) V212D probably damaging Het
Hipk1 A G 3: 103,651,430 (GRCm39) V1111A probably damaging Het
Hormad1 A T 3: 95,483,596 (GRCm39) Q136L probably benign Het
Ifi35 T A 11: 101,348,511 (GRCm39) S147R probably benign Het
Iqca1l A G 5: 24,754,624 (GRCm39) probably null Het
Iqgap3 C T 3: 87,998,089 (GRCm39) A282V probably null Het
Jmy T C 13: 93,590,558 (GRCm39) D515G probably damaging Het
Kctd10 G A 5: 114,512,984 (GRCm39) R64C probably damaging Het
Kidins220 T C 12: 25,040,757 (GRCm39) V121A probably damaging Het
Lcn3 G A 2: 25,656,133 (GRCm39) V63M possibly damaging Het
Lmx1b T A 2: 33,529,543 (GRCm39) Y72F probably benign Het
Lrp1 T C 10: 127,389,424 (GRCm39) D3164G probably damaging Het
Mdh1b C T 1: 63,758,927 (GRCm39) V222M probably damaging Het
Mst1 T C 9: 107,958,702 (GRCm39) probably benign Het
Myo7b C A 18: 32,143,132 (GRCm39) V189F probably damaging Het
Ndc1 T C 4: 107,250,355 (GRCm39) S533P probably damaging Het
Ndrg3 T C 2: 156,785,947 (GRCm39) D164G probably damaging Het
Nol11 C T 11: 107,064,454 (GRCm39) C500Y possibly damaging Het
Nsd3 A G 8: 26,196,642 (GRCm39) N1208D probably benign Het
Nup155 C T 15: 8,186,162 (GRCm39) probably benign Het
Or5ak20 A T 2: 85,183,347 (GRCm39) C308S probably benign Het
Or6c38 A G 10: 128,929,711 (GRCm39) I44T possibly damaging Het
Or8b47 A G 9: 38,435,081 (GRCm39) T18A probably damaging Het
Or8b54 A T 9: 38,687,016 (GRCm39) D155V possibly damaging Het
Phf3 A G 1: 30,844,684 (GRCm39) L1425P probably damaging Het
Pla2r1 A G 2: 60,279,250 (GRCm39) Y777H probably damaging Het
Pld1 A G 3: 28,085,396 (GRCm39) E184G probably damaging Het
Plxna1 T C 6: 89,314,335 (GRCm39) probably null Het
Ptgfrn T C 3: 100,950,718 (GRCm39) E865G probably damaging Het
Ptpn13 G T 5: 103,737,720 (GRCm39) probably benign Het
Pygb G T 2: 150,670,473 (GRCm39) V763F probably benign Het
Ros1 A C 10: 51,967,091 (GRCm39) Y1705* probably null Het
Skint5 A G 4: 113,614,102 (GRCm39) probably null Het
Sntg2 A G 12: 30,362,566 (GRCm39) V60A probably damaging Het
Sppl2a A G 2: 126,762,242 (GRCm39) C280R possibly damaging Het
Srrm4 A C 5: 116,584,603 (GRCm39) M1R probably null Het
Sult1c2 T C 17: 54,279,043 (GRCm39) E91G probably damaging Het
Themis2 C G 4: 132,512,906 (GRCm39) R440P probably damaging Het
Tmem229a A G 6: 24,955,058 (GRCm39) L232P probably benign Het
Trappc1 T C 11: 69,215,248 (GRCm39) F43L probably damaging Het
Trappc11 A T 8: 47,951,708 (GRCm39) Y982N possibly damaging Het
Trpv6 A T 6: 41,604,339 (GRCm39) M139K probably damaging Het
Txnrd3 A G 6: 89,640,057 (GRCm39) probably null Het
Vmn1r184 T A 7: 25,967,008 (GRCm39) Y251* probably null Het
Vmn1r216 A G 13: 23,283,544 (GRCm39) N76D possibly damaging Het
Vmn1r71 C A 7: 10,481,792 (GRCm39) V233F probably benign Het
Vps13a A C 19: 16,743,857 (GRCm39) probably benign Het
Vwa5b2 A G 16: 20,420,358 (GRCm39) S756G probably damaging Het
Wdr36 T A 18: 32,994,538 (GRCm39) probably null Het
Wdr86 A G 5: 24,923,305 (GRCm39) V129A probably benign Het
Zfyve9 A G 4: 108,576,940 (GRCm39) L47S probably benign Het
Other mutations in Sec61a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Sec61a2 APN 2 5,876,831 (GRCm39) missense possibly damaging 0.93
IGL01690:Sec61a2 APN 2 5,891,363 (GRCm39) missense possibly damaging 0.57
IGL01999:Sec61a2 APN 2 5,896,174 (GRCm39) splice site probably benign
IGL02608:Sec61a2 APN 2 5,879,073 (GRCm39) missense probably benign 0.01
IGL03131:Sec61a2 APN 2 5,887,689 (GRCm39) nonsense probably null
IGL03271:Sec61a2 APN 2 5,887,745 (GRCm39) nonsense probably null
IGL03294:Sec61a2 APN 2 5,881,276 (GRCm39) splice site probably null
R0413:Sec61a2 UTSW 2 5,881,165 (GRCm39) intron probably benign
R0742:Sec61a2 UTSW 2 5,881,359 (GRCm39) missense probably benign 0.01
R1659:Sec61a2 UTSW 2 5,891,345 (GRCm39) missense possibly damaging 0.91
R1929:Sec61a2 UTSW 2 5,878,547 (GRCm39) splice site probably benign
R2680:Sec61a2 UTSW 2 5,878,556 (GRCm39) missense probably benign 0.00
R3788:Sec61a2 UTSW 2 5,884,436 (GRCm39) splice site probably null
R4405:Sec61a2 UTSW 2 5,887,670 (GRCm39) missense probably benign 0.40
R4660:Sec61a2 UTSW 2 5,878,504 (GRCm39) intron probably benign
R5387:Sec61a2 UTSW 2 5,887,356 (GRCm39) intron probably benign
R5530:Sec61a2 UTSW 2 5,887,461 (GRCm39) nonsense probably null
R5546:Sec61a2 UTSW 2 5,881,351 (GRCm39) missense possibly damaging 0.78
R5775:Sec61a2 UTSW 2 5,887,585 (GRCm39) splice site probably null
R5922:Sec61a2 UTSW 2 5,879,134 (GRCm39) missense possibly damaging 0.82
R5937:Sec61a2 UTSW 2 5,891,368 (GRCm39) missense probably benign 0.00
R6681:Sec61a2 UTSW 2 5,881,219 (GRCm39) nonsense probably null
R7499:Sec61a2 UTSW 2 5,882,725 (GRCm39) missense probably benign 0.37
R7564:Sec61a2 UTSW 2 5,887,415 (GRCm39) missense probably benign
R7947:Sec61a2 UTSW 2 5,881,794 (GRCm39) missense probably damaging 0.96
R8208:Sec61a2 UTSW 2 5,881,809 (GRCm39) missense probably benign 0.00
R8210:Sec61a2 UTSW 2 5,881,728 (GRCm39) missense possibly damaging 0.95
R8266:Sec61a2 UTSW 2 5,881,650 (GRCm39) critical splice donor site probably null
Z1177:Sec61a2 UTSW 2 5,891,376 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGCCTTCTGACTGTCAC -3'
(R):5'- AGGGTTGGGTTTAAACCTGAAG -3'

Sequencing Primer
(F):5'- ATCTCTGTGAGTTCAAGGCCAGC -3'
(R):5'- GGTGGATGTGATAAACTGCT -3'
Posted On 2015-02-18