Incidental Mutation 'R3522:Sec61a2'
ID267506
Institutional Source Beutler Lab
Gene Symbol Sec61a2
Ensembl Gene ENSMUSG00000025816
Gene NameSec61, alpha subunit 2 (S. cerevisiae)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5870987-5895432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5893216 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 5 (F5L)
Ref Sequence ENSEMBL: ENSMUSP00000141333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026924] [ENSMUST00000026926] [ENSMUST00000095147] [ENSMUST00000102981] [ENSMUST00000193792]
Predicted Effect probably benign
Transcript: ENSMUST00000026924
SMART Domains Protein: ENSMUSP00000026924
Gene: ENSMUSG00000025815

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000026926
AA Change: F5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026926
Gene: ENSMUSG00000025816
AA Change: F5L

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.9e-24 PFAM
Pfam:SecY 75 162 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095147
SMART Domains Protein: ENSMUSP00000092769
Gene: ENSMUSG00000025815

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000102981
AA Change: F5L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100046
Gene: ENSMUSG00000025816
AA Change: F5L

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.2e-21 PFAM
Pfam:SecY 75 458 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150099
Predicted Effect probably benign
Transcript: ENSMUST00000193792
AA Change: F5L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141333
Gene: ENSMUSG00000025816
AA Change: F5L

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 4e-22 PFAM
Pfam:SecY 75 263 5.3e-44 PFAM
Pfam:SecY 261 393 1.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194565
Meta Mutation Damage Score 0.2352 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to a mouse protein which suggests a role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. It may also be required for the assembly of membrane and secretory proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Sec61a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Sec61a2 APN 2 5872020 missense possibly damaging 0.93
IGL01690:Sec61a2 APN 2 5886552 missense possibly damaging 0.57
IGL01999:Sec61a2 APN 2 5891363 splice site probably benign
IGL02608:Sec61a2 APN 2 5874262 missense probably benign 0.01
IGL03131:Sec61a2 APN 2 5882878 nonsense probably null
IGL03271:Sec61a2 APN 2 5882934 nonsense probably null
IGL03294:Sec61a2 APN 2 5876465 splice site probably null
R0413:Sec61a2 UTSW 2 5876354 intron probably benign
R0742:Sec61a2 UTSW 2 5876548 missense probably benign 0.01
R1659:Sec61a2 UTSW 2 5886534 missense possibly damaging 0.91
R1929:Sec61a2 UTSW 2 5873736 splice site probably benign
R2680:Sec61a2 UTSW 2 5873745 missense probably benign 0.00
R3788:Sec61a2 UTSW 2 5879625 splice site probably null
R4405:Sec61a2 UTSW 2 5882859 missense probably benign 0.40
R4660:Sec61a2 UTSW 2 5873693 intron probably benign
R5387:Sec61a2 UTSW 2 5882545 intron probably benign
R5530:Sec61a2 UTSW 2 5882650 nonsense probably null
R5546:Sec61a2 UTSW 2 5876540 missense possibly damaging 0.78
R5775:Sec61a2 UTSW 2 5882774 splice site probably null
R5922:Sec61a2 UTSW 2 5874323 missense possibly damaging 0.82
R5937:Sec61a2 UTSW 2 5886557 missense probably benign 0.00
R6681:Sec61a2 UTSW 2 5876408 nonsense probably null
R7499:Sec61a2 UTSW 2 5877914 missense probably benign 0.37
R7564:Sec61a2 UTSW 2 5882604 missense probably benign
R7947:Sec61a2 UTSW 2 5876983 missense probably damaging 0.96
R8208:Sec61a2 UTSW 2 5876998 missense probably benign 0.00
R8210:Sec61a2 UTSW 2 5876917 missense possibly damaging 0.95
R8266:Sec61a2 UTSW 2 5876839 critical splice donor site probably null
Z1177:Sec61a2 UTSW 2 5886565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGCCTTCTGACTGTCAC -3'
(R):5'- AGGGTTGGGTTTAAACCTGAAG -3'

Sequencing Primer
(F):5'- ATCTCTGTGAGTTCAAGGCCAGC -3'
(R):5'- GGTGGATGTGATAAACTGCT -3'
Posted On2015-02-18