Incidental Mutation 'R3522:Flg2'
ID 267518
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 93104585-93128698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93127334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 2082 (I2082N)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884] [ENSMUST00000194707]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000098884
AA Change: I2082N
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: I2082N

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194707
SMART Domains Protein: ENSMUSP00000141201
Gene: ENSMUSG00000049133

DomainStartEndE-ValueType
SCOP:d1qlka_ 1 35 6e-10 SMART
low complexity region 53 64 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,592,378 (GRCm39) E888G probably damaging Het
Arhgef10 T C 8: 15,004,918 (GRCm39) F150S probably damaging Het
Atp10d G T 5: 72,396,500 (GRCm39) R235L probably benign Het
Cacna1b A G 2: 24,653,055 (GRCm39) V2A possibly damaging Het
Cand1 A T 10: 119,075,102 (GRCm39) L15Q probably benign Het
Cavin3 C A 7: 105,130,350 (GRCm39) G154V probably benign Het
Ccdc73 A T 2: 104,821,830 (GRCm39) D593V probably damaging Het
Cdk5rap2 T C 4: 70,168,647 (GRCm39) K161E probably damaging Het
Chil4 A T 3: 106,111,056 (GRCm39) N279K probably benign Het
Chst13 T G 6: 90,295,245 (GRCm39) D56A probably damaging Het
Cnn1 C A 9: 22,010,664 (GRCm39) H5N probably benign Het
Cpsf4l T A 11: 113,593,319 (GRCm39) K88N probably damaging Het
Ctnnbl1 G T 2: 157,713,113 (GRCm39) probably null Het
Dnah7a A C 1: 53,657,275 (GRCm39) F834V probably damaging Het
Fbxo41 A G 6: 85,461,163 (GRCm39) S182P probably benign Het
Fkbp5 T C 17: 28,634,970 (GRCm39) T180A probably benign Het
Gm4968 A G 6: 127,210,725 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 116,761,747 (GRCm39) H612Q probably benign Het
Gsg1 A T 6: 135,218,251 (GRCm39) V212D probably damaging Het
Hipk1 A G 3: 103,651,430 (GRCm39) V1111A probably damaging Het
Hormad1 A T 3: 95,483,596 (GRCm39) Q136L probably benign Het
Ifi35 T A 11: 101,348,511 (GRCm39) S147R probably benign Het
Iqca1l A G 5: 24,754,624 (GRCm39) probably null Het
Iqgap3 C T 3: 87,998,089 (GRCm39) A282V probably null Het
Jmy T C 13: 93,590,558 (GRCm39) D515G probably damaging Het
Kctd10 G A 5: 114,512,984 (GRCm39) R64C probably damaging Het
Kidins220 T C 12: 25,040,757 (GRCm39) V121A probably damaging Het
Lcn3 G A 2: 25,656,133 (GRCm39) V63M possibly damaging Het
Lmx1b T A 2: 33,529,543 (GRCm39) Y72F probably benign Het
Lrp1 T C 10: 127,389,424 (GRCm39) D3164G probably damaging Het
Mdh1b C T 1: 63,758,927 (GRCm39) V222M probably damaging Het
Mst1 T C 9: 107,958,702 (GRCm39) probably benign Het
Myo7b C A 18: 32,143,132 (GRCm39) V189F probably damaging Het
Ndc1 T C 4: 107,250,355 (GRCm39) S533P probably damaging Het
Ndrg3 T C 2: 156,785,947 (GRCm39) D164G probably damaging Het
Nol11 C T 11: 107,064,454 (GRCm39) C500Y possibly damaging Het
Nsd3 A G 8: 26,196,642 (GRCm39) N1208D probably benign Het
Nup155 C T 15: 8,186,162 (GRCm39) probably benign Het
Or5ak20 A T 2: 85,183,347 (GRCm39) C308S probably benign Het
Or6c38 A G 10: 128,929,711 (GRCm39) I44T possibly damaging Het
Or8b47 A G 9: 38,435,081 (GRCm39) T18A probably damaging Het
Or8b54 A T 9: 38,687,016 (GRCm39) D155V possibly damaging Het
Phf3 A G 1: 30,844,684 (GRCm39) L1425P probably damaging Het
Pla2r1 A G 2: 60,279,250 (GRCm39) Y777H probably damaging Het
Pld1 A G 3: 28,085,396 (GRCm39) E184G probably damaging Het
Plxna1 T C 6: 89,314,335 (GRCm39) probably null Het
Ptgfrn T C 3: 100,950,718 (GRCm39) E865G probably damaging Het
Ptpn13 G T 5: 103,737,720 (GRCm39) probably benign Het
Pygb G T 2: 150,670,473 (GRCm39) V763F probably benign Het
Ros1 A C 10: 51,967,091 (GRCm39) Y1705* probably null Het
Sec61a2 A G 2: 5,898,027 (GRCm39) F5L probably benign Het
Skint5 A G 4: 113,614,102 (GRCm39) probably null Het
Sntg2 A G 12: 30,362,566 (GRCm39) V60A probably damaging Het
Sppl2a A G 2: 126,762,242 (GRCm39) C280R possibly damaging Het
Srrm4 A C 5: 116,584,603 (GRCm39) M1R probably null Het
Sult1c2 T C 17: 54,279,043 (GRCm39) E91G probably damaging Het
Themis2 C G 4: 132,512,906 (GRCm39) R440P probably damaging Het
Tmem229a A G 6: 24,955,058 (GRCm39) L232P probably benign Het
Trappc1 T C 11: 69,215,248 (GRCm39) F43L probably damaging Het
Trappc11 A T 8: 47,951,708 (GRCm39) Y982N possibly damaging Het
Trpv6 A T 6: 41,604,339 (GRCm39) M139K probably damaging Het
Txnrd3 A G 6: 89,640,057 (GRCm39) probably null Het
Vmn1r184 T A 7: 25,967,008 (GRCm39) Y251* probably null Het
Vmn1r216 A G 13: 23,283,544 (GRCm39) N76D possibly damaging Het
Vmn1r71 C A 7: 10,481,792 (GRCm39) V233F probably benign Het
Vps13a A C 19: 16,743,857 (GRCm39) probably benign Het
Vwa5b2 A G 16: 20,420,358 (GRCm39) S756G probably damaging Het
Wdr36 T A 18: 32,994,538 (GRCm39) probably null Het
Wdr86 A G 5: 24,923,305 (GRCm39) V129A probably benign Het
Zfyve9 A G 4: 108,576,940 (GRCm39) L47S probably benign Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93,109,416 (GRCm39) nonsense probably null
IGL00092:Flg2 APN 3 93,127,162 (GRCm39) missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93,110,585 (GRCm39) missense unknown
IGL01077:Flg2 APN 3 93,127,513 (GRCm39) missense unknown
IGL01093:Flg2 APN 3 93,109,678 (GRCm39) missense unknown
IGL01120:Flg2 APN 3 93,108,475 (GRCm39) missense probably damaging 0.99
IGL01473:Flg2 APN 3 93,110,327 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,122,777 (GRCm39) missense unknown
IGL01584:Flg2 APN 3 93,120,773 (GRCm39) missense unknown
IGL01686:Flg2 APN 3 93,109,591 (GRCm39) missense unknown
IGL02207:Flg2 APN 3 93,127,435 (GRCm39) missense unknown
IGL02294:Flg2 APN 3 93,111,053 (GRCm39) missense unknown
IGL02418:Flg2 APN 3 93,108,361 (GRCm39) missense probably benign 0.26
IGL02581:Flg2 APN 3 93,127,199 (GRCm39) missense unknown
IGL02719:Flg2 APN 3 93,127,438 (GRCm39) nonsense probably null
IGL02795:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02893:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL02958:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03060:Flg2 APN 3 93,110,920 (GRCm39) missense unknown
IGL03088:Flg2 APN 3 93,110,498 (GRCm39) missense unknown
IGL03165:Flg2 APN 3 93,121,918 (GRCm39) missense unknown
IGL03342:Flg2 APN 3 93,108,542 (GRCm39) missense probably damaging 1.00
IGL03352:Flg2 APN 3 93,109,801 (GRCm39) missense unknown
IGL02796:Flg2 UTSW 3 93,110,920 (GRCm39) missense unknown
IGL02837:Flg2 UTSW 3 93,109,044 (GRCm39) missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93,111,088 (GRCm39) missense unknown
R0087:Flg2 UTSW 3 93,109,738 (GRCm39) missense unknown
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0233:Flg2 UTSW 3 93,109,104 (GRCm39) nonsense probably null
R0315:Flg2 UTSW 3 93,122,029 (GRCm39) missense unknown
R0390:Flg2 UTSW 3 93,107,662 (GRCm39) splice site probably benign
R0462:Flg2 UTSW 3 93,108,744 (GRCm39) missense probably benign 0.18
R0553:Flg2 UTSW 3 93,110,891 (GRCm39) missense unknown
R0828:Flg2 UTSW 3 93,110,639 (GRCm39) missense unknown
R1006:Flg2 UTSW 3 93,108,514 (GRCm39) missense probably benign 0.41
R1444:Flg2 UTSW 3 93,109,620 (GRCm39) missense unknown
R1497:Flg2 UTSW 3 93,127,076 (GRCm39) missense unknown
R1518:Flg2 UTSW 3 93,110,445 (GRCm39) missense unknown
R1737:Flg2 UTSW 3 93,110,928 (GRCm39) missense unknown
R1780:Flg2 UTSW 3 93,110,306 (GRCm39) missense unknown
R1797:Flg2 UTSW 3 93,108,283 (GRCm39) missense probably damaging 1.00
R2065:Flg2 UTSW 3 93,109,538 (GRCm39) missense unknown
R2168:Flg2 UTSW 3 93,109,244 (GRCm39) missense probably damaging 1.00
R2220:Flg2 UTSW 3 93,109,492 (GRCm39) missense unknown
R2292:Flg2 UTSW 3 93,127,984 (GRCm39) missense unknown
R2327:Flg2 UTSW 3 93,110,913 (GRCm39) nonsense probably null
R2512:Flg2 UTSW 3 93,109,082 (GRCm39) missense probably damaging 1.00
R3177:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3277:Flg2 UTSW 3 93,122,195 (GRCm39) missense unknown
R3779:Flg2 UTSW 3 93,109,730 (GRCm39) missense unknown
R3926:Flg2 UTSW 3 93,110,522 (GRCm39) missense unknown
R4082:Flg2 UTSW 3 93,110,828 (GRCm39) missense unknown
R4407:Flg2 UTSW 3 93,122,176 (GRCm39) missense unknown
R5152:Flg2 UTSW 3 93,122,284 (GRCm39) missense unknown
R5253:Flg2 UTSW 3 93,108,119 (GRCm39) missense probably damaging 1.00
R5290:Flg2 UTSW 3 93,127,873 (GRCm39) missense unknown
R5464:Flg2 UTSW 3 93,109,277 (GRCm39) missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93,127,753 (GRCm39) missense unknown
R5622:Flg2 UTSW 3 93,109,871 (GRCm39) missense unknown
R5788:Flg2 UTSW 3 93,108,296 (GRCm39) missense probably benign 0.41
R5792:Flg2 UTSW 3 93,110,804 (GRCm39) missense unknown
R5831:Flg2 UTSW 3 93,107,541 (GRCm39) missense probably damaging 1.00
R5877:Flg2 UTSW 3 93,110,756 (GRCm39) missense unknown
R6041:Flg2 UTSW 3 93,127,668 (GRCm39) missense probably benign 0.01
R6189:Flg2 UTSW 3 93,127,381 (GRCm39) missense unknown
R6214:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93,109,166 (GRCm39) missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93,108,579 (GRCm39) missense probably benign 0.36
R6288:Flg2 UTSW 3 93,111,092 (GRCm39) missense unknown
R6413:Flg2 UTSW 3 93,127,683 (GRCm39) missense unknown
R6457:Flg2 UTSW 3 93,127,789 (GRCm39) missense unknown
R6468:Flg2 UTSW 3 93,121,728 (GRCm39) missense unknown
R6667:Flg2 UTSW 3 93,109,068 (GRCm39) missense possibly damaging 0.88
R6930:Flg2 UTSW 3 93,108,642 (GRCm39) nonsense probably null
R6996:Flg2 UTSW 3 93,110,256 (GRCm39) missense unknown
R6996:Flg2 UTSW 3 93,109,977 (GRCm39) missense unknown
R7100:Flg2 UTSW 3 93,111,018 (GRCm39) missense unknown
R7133:Flg2 UTSW 3 93,127,069 (GRCm39) missense unknown
R7180:Flg2 UTSW 3 93,110,140 (GRCm39) missense unknown
R7325:Flg2 UTSW 3 93,110,679 (GRCm39) missense unknown
R7349:Flg2 UTSW 3 93,127,513 (GRCm39) missense unknown
R7531:Flg2 UTSW 3 93,108,177 (GRCm39) missense probably damaging 0.99
R7571:Flg2 UTSW 3 93,127,303 (GRCm39) nonsense probably null
R7684:Flg2 UTSW 3 93,126,956 (GRCm39) missense unknown
R7810:Flg2 UTSW 3 93,107,548 (GRCm39) missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93,128,054 (GRCm39) missense unknown
R8031:Flg2 UTSW 3 93,127,521 (GRCm39) missense unknown
R8078:Flg2 UTSW 3 93,107,582 (GRCm39) missense probably damaging 1.00
R8142:Flg2 UTSW 3 93,122,782 (GRCm39) nonsense probably null
R8156:Flg2 UTSW 3 93,127,390 (GRCm39) missense unknown
R8172:Flg2 UTSW 3 93,108,468 (GRCm39) missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93,110,074 (GRCm39) missense unknown
R8262:Flg2 UTSW 3 93,127,517 (GRCm39) missense unknown
R8269:Flg2 UTSW 3 93,109,187 (GRCm39) missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93,110,069 (GRCm39) missense unknown
R8444:Flg2 UTSW 3 93,107,585 (GRCm39) missense probably damaging 0.97
R8670:Flg2 UTSW 3 93,108,791 (GRCm39) missense probably damaging 0.97
R8755:Flg2 UTSW 3 93,108,120 (GRCm39) missense probably damaging 1.00
R9039:Flg2 UTSW 3 93,110,899 (GRCm39) missense unknown
R9116:Flg2 UTSW 3 93,109,591 (GRCm39) missense unknown
R9214:Flg2 UTSW 3 93,110,884 (GRCm39) missense unknown
R9231:Flg2 UTSW 3 93,109,508 (GRCm39) missense unknown
R9553:Flg2 UTSW 3 93,121,901 (GRCm39) missense unknown
R9607:Flg2 UTSW 3 93,108,719 (GRCm39) missense probably damaging 0.98
R9735:Flg2 UTSW 3 93,127,669 (GRCm39) missense unknown
R9752:Flg2 UTSW 3 93,108,467 (GRCm39) missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93,110,045 (GRCm39) missense unknown
Z1177:Flg2 UTSW 3 93,109,727 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGACTTTCTGGCCATTATGGAAG -3'
(R):5'- ACTACTACAGAATGGCCATGACTAC -3'

Sequencing Primer
(F):5'- CTTTCTGGCCATTATGGAAGAAATC -3'
(R):5'- TGGCCATGACTACACTCATG -3'
Posted On 2015-02-18