Incidental Mutation 'R3522:Hormad1'
ID 267519
Institutional Source Beutler Lab
Gene Symbol Hormad1
Ensembl Gene ENSMUSG00000028109
Gene Name HORMA domain containing 1
Synonyms Nohma, 4921522K05Rik
Accession Numbers

Genbank: NM_026489.2; Ensembl: ENSMUST00000107154, ENSMUST00000090797, ENSMUST00000029754, ENSMUST00000171191

Essential gene? Non essential (E-score: 0.000) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 95559677-95587671 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 95576285 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 136 (Q136L)
Ref Sequence ENSEMBL: ENSMUSP00000127180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029754] [ENSMUST00000090797] [ENSMUST00000107154] [ENSMUST00000171191]
AlphaFold Q9D5T7
Predicted Effect probably benign
Transcript: ENSMUST00000029754
AA Change: Q136L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029754
Gene: ENSMUSG00000028109
AA Change: Q136L

DomainStartEndE-ValueType
Pfam:HORMA 24 221 4.7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090797
AA Change: Q136L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000088303
Gene: ENSMUSG00000028109
AA Change: Q136L

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107154
AA Change: Q136L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102772
Gene: ENSMUSG00000028109
AA Change: Q136L

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171191
AA Change: Q136L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127180
Gene: ENSMUSG00000028109
AA Change: Q136L

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Meta Mutation Damage Score 0.1414 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HORMA domain-containing protein. HORMA domains are involved in chromatin binding and play a role in cell cycle regulation. The encoded protein may play a role in meiosis, and expression of this gene is a potential marker for cancer. A pseudogene of this gene is located on the long arm of chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozgous mice are infertile because of meiosis arrest associated with impaired synaptonemal-complex formation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Hormad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Hormad1 APN 3 95578297 missense possibly damaging 0.49
IGL01686:Hormad1 APN 3 95578269 missense probably benign 0.02
IGL02023:Hormad1 APN 3 95578293 missense possibly damaging 0.91
B6584:Hormad1 UTSW 3 95570696 splice site probably benign
R0025:Hormad1 UTSW 3 95585125 unclassified probably benign
R0662:Hormad1 UTSW 3 95575599 missense probably benign 0.01
R0704:Hormad1 UTSW 3 95566686 critical splice donor site probably null
R1854:Hormad1 UTSW 3 95580006 missense probably benign 0.08
R2199:Hormad1 UTSW 3 95567722 critical splice donor site probably null
R2371:Hormad1 UTSW 3 95575599 missense probably benign 0.18
R2411:Hormad1 UTSW 3 95580015 missense probably benign 0.41
R4075:Hormad1 UTSW 3 95578203 missense possibly damaging 0.47
R4202:Hormad1 UTSW 3 95585198 missense probably benign 0.00
R4535:Hormad1 UTSW 3 95585141 missense probably benign 0.00
R4536:Hormad1 UTSW 3 95585141 missense probably benign 0.00
R4844:Hormad1 UTSW 3 95570931 missense probably damaging 0.98
R4903:Hormad1 UTSW 3 95585220 splice site probably null
R4964:Hormad1 UTSW 3 95585220 splice site probably null
R5135:Hormad1 UTSW 3 95585220 unclassified probably benign
R5208:Hormad1 UTSW 3 95578107 missense possibly damaging 0.46
R5372:Hormad1 UTSW 3 95576424 missense probably damaging 1.00
R5825:Hormad1 UTSW 3 95562559 missense probably damaging 0.97
R5895:Hormad1 UTSW 3 95559733 critical splice donor site probably null
R6124:Hormad1 UTSW 3 95576302 missense probably benign
R6453:Hormad1 UTSW 3 95578257 missense probably benign 0.02
R7308:Hormad1 UTSW 3 95562555 missense probably damaging 0.99
R7373:Hormad1 UTSW 3 95576317 missense probably damaging 1.00
R8744:Hormad1 UTSW 3 95562615 missense possibly damaging 0.79
R9040:Hormad1 UTSW 3 95580159 missense possibly damaging 0.68
R9360:Hormad1 UTSW 3 95576311 missense probably benign 0.03
R9790:Hormad1 UTSW 3 95587382 missense probably benign 0.13
R9791:Hormad1 UTSW 3 95587382 missense probably benign 0.13
X0025:Hormad1 UTSW 3 95581567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACAAGACAAAATTATGTGCTG -3'
(R):5'- GCAACAATTTAGGTGCCAAAAC -3'

Sequencing Primer
(F):5'- CAAAAAAGTATTTGAGTGG -3'
(R):5'- TTAGGTGCCAAAACATTAAAAATGG -3'
Posted On 2015-02-18