Incidental Mutation 'R3522:Cdk5rap2'
ID 267525
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70168647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 161 (K161E)
Ref Sequence ENSEMBL: ENSMUSP00000116928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120944
Predicted Effect probably damaging
Transcript: ENSMUST00000138561
AA Change: K161E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298
AA Change: K161E

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140108
AA Change: K55E
Predicted Effect probably damaging
Transcript: ENSMUST00000144099
AA Change: K1421E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: K1421E

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Meta Mutation Damage Score 0.0671 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,592,378 (GRCm39) E888G probably damaging Het
Arhgef10 T C 8: 15,004,918 (GRCm39) F150S probably damaging Het
Atp10d G T 5: 72,396,500 (GRCm39) R235L probably benign Het
Cacna1b A G 2: 24,653,055 (GRCm39) V2A possibly damaging Het
Cand1 A T 10: 119,075,102 (GRCm39) L15Q probably benign Het
Cavin3 C A 7: 105,130,350 (GRCm39) G154V probably benign Het
Ccdc73 A T 2: 104,821,830 (GRCm39) D593V probably damaging Het
Chil4 A T 3: 106,111,056 (GRCm39) N279K probably benign Het
Chst13 T G 6: 90,295,245 (GRCm39) D56A probably damaging Het
Cnn1 C A 9: 22,010,664 (GRCm39) H5N probably benign Het
Cpsf4l T A 11: 113,593,319 (GRCm39) K88N probably damaging Het
Ctnnbl1 G T 2: 157,713,113 (GRCm39) probably null Het
Dnah7a A C 1: 53,657,275 (GRCm39) F834V probably damaging Het
Fbxo41 A G 6: 85,461,163 (GRCm39) S182P probably benign Het
Fkbp5 T C 17: 28,634,970 (GRCm39) T180A probably benign Het
Flg2 T A 3: 93,127,334 (GRCm39) I2082N unknown Het
Gm4968 A G 6: 127,210,725 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 116,761,747 (GRCm39) H612Q probably benign Het
Gsg1 A T 6: 135,218,251 (GRCm39) V212D probably damaging Het
Hipk1 A G 3: 103,651,430 (GRCm39) V1111A probably damaging Het
Hormad1 A T 3: 95,483,596 (GRCm39) Q136L probably benign Het
Ifi35 T A 11: 101,348,511 (GRCm39) S147R probably benign Het
Iqca1l A G 5: 24,754,624 (GRCm39) probably null Het
Iqgap3 C T 3: 87,998,089 (GRCm39) A282V probably null Het
Jmy T C 13: 93,590,558 (GRCm39) D515G probably damaging Het
Kctd10 G A 5: 114,512,984 (GRCm39) R64C probably damaging Het
Kidins220 T C 12: 25,040,757 (GRCm39) V121A probably damaging Het
Lcn3 G A 2: 25,656,133 (GRCm39) V63M possibly damaging Het
Lmx1b T A 2: 33,529,543 (GRCm39) Y72F probably benign Het
Lrp1 T C 10: 127,389,424 (GRCm39) D3164G probably damaging Het
Mdh1b C T 1: 63,758,927 (GRCm39) V222M probably damaging Het
Mst1 T C 9: 107,958,702 (GRCm39) probably benign Het
Myo7b C A 18: 32,143,132 (GRCm39) V189F probably damaging Het
Ndc1 T C 4: 107,250,355 (GRCm39) S533P probably damaging Het
Ndrg3 T C 2: 156,785,947 (GRCm39) D164G probably damaging Het
Nol11 C T 11: 107,064,454 (GRCm39) C500Y possibly damaging Het
Nsd3 A G 8: 26,196,642 (GRCm39) N1208D probably benign Het
Nup155 C T 15: 8,186,162 (GRCm39) probably benign Het
Or5ak20 A T 2: 85,183,347 (GRCm39) C308S probably benign Het
Or6c38 A G 10: 128,929,711 (GRCm39) I44T possibly damaging Het
Or8b47 A G 9: 38,435,081 (GRCm39) T18A probably damaging Het
Or8b54 A T 9: 38,687,016 (GRCm39) D155V possibly damaging Het
Phf3 A G 1: 30,844,684 (GRCm39) L1425P probably damaging Het
Pla2r1 A G 2: 60,279,250 (GRCm39) Y777H probably damaging Het
Pld1 A G 3: 28,085,396 (GRCm39) E184G probably damaging Het
Plxna1 T C 6: 89,314,335 (GRCm39) probably null Het
Ptgfrn T C 3: 100,950,718 (GRCm39) E865G probably damaging Het
Ptpn13 G T 5: 103,737,720 (GRCm39) probably benign Het
Pygb G T 2: 150,670,473 (GRCm39) V763F probably benign Het
Ros1 A C 10: 51,967,091 (GRCm39) Y1705* probably null Het
Sec61a2 A G 2: 5,898,027 (GRCm39) F5L probably benign Het
Skint5 A G 4: 113,614,102 (GRCm39) probably null Het
Sntg2 A G 12: 30,362,566 (GRCm39) V60A probably damaging Het
Sppl2a A G 2: 126,762,242 (GRCm39) C280R possibly damaging Het
Srrm4 A C 5: 116,584,603 (GRCm39) M1R probably null Het
Sult1c2 T C 17: 54,279,043 (GRCm39) E91G probably damaging Het
Themis2 C G 4: 132,512,906 (GRCm39) R440P probably damaging Het
Tmem229a A G 6: 24,955,058 (GRCm39) L232P probably benign Het
Trappc1 T C 11: 69,215,248 (GRCm39) F43L probably damaging Het
Trappc11 A T 8: 47,951,708 (GRCm39) Y982N possibly damaging Het
Trpv6 A T 6: 41,604,339 (GRCm39) M139K probably damaging Het
Txnrd3 A G 6: 89,640,057 (GRCm39) probably null Het
Vmn1r184 T A 7: 25,967,008 (GRCm39) Y251* probably null Het
Vmn1r216 A G 13: 23,283,544 (GRCm39) N76D possibly damaging Het
Vmn1r71 C A 7: 10,481,792 (GRCm39) V233F probably benign Het
Vps13a A C 19: 16,743,857 (GRCm39) probably benign Het
Vwa5b2 A G 16: 20,420,358 (GRCm39) S756G probably damaging Het
Wdr36 T A 18: 32,994,538 (GRCm39) probably null Het
Wdr86 A G 5: 24,923,305 (GRCm39) V129A probably benign Het
Zfyve9 A G 4: 108,576,940 (GRCm39) L47S probably benign Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTGAGGGCACAGCTACAG -3'
(R):5'- AAGAATTGCCAGCTGCTGACTG -3'

Sequencing Primer
(F):5'- TACAGCTTAGGACCCCAGAGG -3'
(R):5'- GCTGACTGTCTCGATATATCCAATAC -3'
Posted On 2015-02-18