Mutagenetix > Incidental Mutation

Incidental Mutation 'R3522:Plxna1'

267539

Institutional Source

Beutler Lab

Gene Symbol

Plxna1

Ensembl Gene

ENSMUSG00000030084

Gene Name

plexin A1

Synonyms

NOV, Plxn1, PlexA1, 2600013D04Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.826) question?

Stock #

R3522 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

89316314-89362620 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 89337353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000131840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000049845] [ENSMUST00000163139] [ENSMUST00000163139]

AlphaFold

P70206

Predicted Effect

probably null
Transcript: ENSMUST00000049845

SMART Domains

Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1316	1864	8.8e-263	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000049845

SMART Domains

Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1316	1864	8.8e-263	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000163139

SMART Domains

Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1315	1864	2.5e-264	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000163139

SMART Domains

Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1315	1864	2.5e-264	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204997

Predicted Effect

probably benign
Transcript: ENSMUST00000205121

Meta Mutation Damage Score

0.9499

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,549,626		probably null	Het
Ankrd35	A	G	3: 96,685,062	E888G	probably damaging	Het
Arhgef10	T	C	8: 14,954,918	F150S	probably damaging	Het
Atp10d	G	T	5: 72,239,157	R235L	probably benign	Het
Cacna1b	A	G	2: 24,763,043	V2A	possibly damaging	Het
Cand1	A	T	10: 119,239,197	L15Q	probably benign	Het
Cavin3	C	A	7: 105,481,143	G154V	probably benign	Het
Ccdc73	A	T	2: 104,991,485	D593V	probably damaging	Het
Cdk5rap2	T	C	4: 70,250,410	K161E	probably damaging	Het
Chil4	A	T	3: 106,203,740	N279K	probably benign	Het
Chst13	T	G	6: 90,318,263	D56A	probably damaging	Het
Cnn1	C	A	9: 22,099,368	H5N	probably benign	Het
Cpsf4l	T	A	11: 113,702,493	K88N	probably damaging	Het
Ctnnbl1	G	T	2: 157,871,193		probably null	Het
Dnah7a	A	C	1: 53,618,116	F834V	probably damaging	Het
Fbxo41	A	G	6: 85,484,181	S182P	probably benign	Het
Fkbp5	T	C	17: 28,415,996	T180A	probably benign	Het
Flg2	T	A	3: 93,220,027	I2082N	unknown	Het
Gm4968	A	G	6: 127,233,762		noncoding transcript	Het
Gpc5	T	A	14: 116,524,335	H612Q	probably benign	Het
Gsg1	A	T	6: 135,241,253	V212D	probably damaging	Het
Hipk1	A	G	3: 103,744,114	V1111A	probably damaging	Het
Hormad1	A	T	3: 95,576,285	Q136L	probably benign	Het
Ifi35	T	A	11: 101,457,685	S147R	probably benign	Het
Iqgap3	C	T	3: 88,090,782	A282V	probably null	Het
Jmy	T	C	13: 93,454,050	D515G	probably damaging	Het
Kctd10	G	A	5: 114,374,923	R64C	probably damaging	Het
Kidins220	T	C	12: 24,990,758	V121A	probably damaging	Het
Lcn3	G	A	2: 25,766,121	V63M	possibly damaging	Het
Lmx1b	T	A	2: 33,639,531	Y72F	probably benign	Het
Lrp1	T	C	10: 127,553,555	D3164G	probably damaging	Het
Mdh1b	C	T	1: 63,719,768	V222M	probably damaging	Het
Mst1	T	C	9: 108,081,503		probably benign	Het
Myo7b	C	A	18: 32,010,079	V189F	probably damaging	Het
Ndc1	T	C	4: 107,393,158	S533P	probably damaging	Het
Ndrg3	T	C	2: 156,944,027	D164G	probably damaging	Het
Nol11	C	T	11: 107,173,628	C500Y	possibly damaging	Het
Nsd3	A	G	8: 25,706,614	N1208D	probably benign	Het
Nup155	C	T	15: 8,156,678		probably benign	Het
Olfr768	A	G	10: 129,093,842	I44T	possibly damaging	Het
Olfr911-ps1	A	G	9: 38,523,785	T18A	probably damaging	Het
Olfr921	A	T	9: 38,775,720	D155V	possibly damaging	Het
Olfr988	A	T	2: 85,353,003	C308S	probably benign	Het
Phf3	A	G	1: 30,805,603	L1425P	probably damaging	Het
Pla2r1	A	G	2: 60,448,906	Y777H	probably damaging	Het
Pld1	A	G	3: 28,031,247	E184G	probably damaging	Het
Ptgfrn	T	C	3: 101,043,402	E865G	probably damaging	Het
Ptpn13	G	T	5: 103,589,854		probably benign	Het
Pygb	G	T	2: 150,828,553	V763F	probably benign	Het
Ros1	A	C	10: 52,090,995	Y1705*	probably null	Het
Sec61a2	A	G	2: 5,893,216	F5L	probably benign	Het
Skint5	A	G	4: 113,756,905		probably null	Het
Sntg2	A	G	12: 30,312,567	V60A	probably damaging	Het
Sppl2a	A	G	2: 126,920,322	C280R	possibly damaging	Het
Srrm4	A	C	5: 116,446,544	M1R	probably null	Het
Sult1c1	T	C	17: 53,972,015	E91G	probably damaging	Het
Themis2	C	G	4: 132,785,595	R440P	probably damaging	Het
Tmem229a	A	G	6: 24,955,059	L232P	probably benign	Het
Trappc1	T	C	11: 69,324,422	F43L	probably damaging	Het
Trappc11	A	T	8: 47,498,673	Y982N	possibly damaging	Het
Trpv6	A	T	6: 41,627,405	M139K	probably damaging	Het
Txnrd3	A	G	6: 89,663,075		probably null	Het
Vmn1r184	T	A	7: 26,267,583	Y251*	probably null	Het
Vmn1r216	A	G	13: 23,099,374	N76D	possibly damaging	Het
Vmn1r71	C	A	7: 10,747,865	V233F	probably benign	Het
Vps13a	A	C	19: 16,766,493		probably benign	Het
Vwa5b2	A	G	16: 20,601,608	S756G	probably damaging	Het
Wdr36	T	A	18: 32,861,485		probably null	Het
Wdr86	A	G	5: 24,718,307	V129A	probably benign	Het
Zfyve9	A	G	4: 108,719,743	L47S	probably benign	Het

Other mutations in Plxna1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Plxna1	APN	6	89320998	missense	probably damaging	1.00
IGL01358:Plxna1	APN	6	89322750	missense	probably damaging	1.00
IGL01475:Plxna1	APN	6	89354888	missense	possibly damaging	0.92
IGL01480:Plxna1	APN	6	89344096	missense	possibly damaging	0.70
IGL01585:Plxna1	APN	6	89329556	critical splice donor site	probably null
IGL01804:Plxna1	APN	6	89329646	missense	probably damaging	1.00
IGL01909:Plxna1	APN	6	89332084	critical splice donor site	probably null
IGL01989:Plxna1	APN	6	89329414	nonsense	probably null
IGL02015:Plxna1	APN	6	89342451	missense	probably damaging	1.00
IGL02023:Plxna1	APN	6	89357332	missense	possibly damaging	0.88
IGL02668:Plxna1	APN	6	89357269	nonsense	probably null
IGL02703:Plxna1	APN	6	89356943	missense	probably damaging	1.00
IGL02954:Plxna1	APN	6	89324667	missense	probably damaging	1.00
IGL03212:Plxna1	APN	6	89331903	missense	probably damaging	1.00
PIT4544001:Plxna1	UTSW	6	89357429	missense	probably benign	0.14
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0147:Plxna1	UTSW	6	89320710	missense	possibly damaging	0.95
R0149:Plxna1	UTSW	6	89320613	missense	probably null	0.95
R0166:Plxna1	UTSW	6	89333019	missense	probably damaging	1.00
R0200:Plxna1	UTSW	6	89323593	missense	probably damaging	1.00
R0415:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
R0841:Plxna1	UTSW	6	89332204	missense	probably damaging	1.00
R1018:Plxna1	UTSW	6	89342960	missense	probably damaging	1.00
R1240:Plxna1	UTSW	6	89321050	missense	probably damaging	1.00
R1355:Plxna1	UTSW	6	89320766	unclassified	probably benign
R1700:Plxna1	UTSW	6	89357008	missense	probably damaging	1.00
R1776:Plxna1	UTSW	6	89335464	missense	probably benign	0.00
R1957:Plxna1	UTSW	6	89331291	missense	probably damaging	1.00
R2314:Plxna1	UTSW	6	89324316	missense	probably damaging	1.00
R2968:Plxna1	UTSW	6	89342608	missense	probably damaging	1.00
R3118:Plxna1	UTSW	6	89356976	missense	possibly damaging	0.89
R3619:Plxna1	UTSW	6	89357453	missense	probably damaging	0.97
R3766:Plxna1	UTSW	6	89334775	unclassified	probably benign
R3847:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3849:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3872:Plxna1	UTSW	6	89332692	nonsense	probably null
R4555:Plxna1	UTSW	6	89323328	missense	probably damaging	0.99
R4709:Plxna1	UTSW	6	89334751	missense	possibly damaging	0.72
R4726:Plxna1	UTSW	6	89322816	missense	probably damaging	1.00
R4739:Plxna1	UTSW	6	89332675	splice site	probably null
R5053:Plxna1	UTSW	6	89322460	missense	probably damaging	1.00
R5221:Plxna1	UTSW	6	89321016	missense	probably damaging	1.00
R5449:Plxna1	UTSW	6	89323608	missense	probably damaging	1.00
R5480:Plxna1	UTSW	6	89324634	missense	probably damaging	1.00
R5575:Plxna1	UTSW	6	89324541	missense	possibly damaging	0.83
R5743:Plxna1	UTSW	6	89356529	missense	probably damaging	1.00
R5744:Plxna1	UTSW	6	89334682	missense	possibly damaging	0.67
R5754:Plxna1	UTSW	6	89333105	missense	possibly damaging	0.96
R5868:Plxna1	UTSW	6	89322722	splice site	probably benign
R5988:Plxna1	UTSW	6	89357540	nonsense	probably null
R6190:Plxna1	UTSW	6	89356604	nonsense	probably null
R6425:Plxna1	UTSW	6	89334665	missense	probably benign	0.00
R6561:Plxna1	UTSW	6	89356978	missense	probably damaging	1.00
R6623:Plxna1	UTSW	6	89322771	missense	probably damaging	1.00
R6638:Plxna1	UTSW	6	89324400	missense	probably damaging	0.97
R6701:Plxna1	UTSW	6	89319448	missense	probably damaging	0.99
R6825:Plxna1	UTSW	6	89320615	missense	probably benign	0.01
R6911:Plxna1	UTSW	6	89320974	missense	probably damaging	1.00
R7073:Plxna1	UTSW	6	89357329	missense	probably damaging	1.00
R7177:Plxna1	UTSW	6	89323329	missense	possibly damaging	0.50
R7235:Plxna1	UTSW	6	89340591	missense	probably damaging	0.97
R7419:Plxna1	UTSW	6	89357602	missense	unknown
R7511:Plxna1	UTSW	6	89341907	missense	possibly damaging	0.71
R7543:Plxna1	UTSW	6	89322855	missense	probably damaging	1.00
R7665:Plxna1	UTSW	6	89324538	critical splice donor site	probably null
R7678:Plxna1	UTSW	6	89331900	missense	probably damaging	0.99
R7748:Plxna1	UTSW	6	89337352	critical splice acceptor site	probably null
R7748:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R7877:Plxna1	UTSW	6	89323259	missense	probably damaging	0.99
R8025:Plxna1	UTSW	6	89331272	missense	probably damaging	1.00
R8171:Plxna1	UTSW	6	89357120	missense	probably benign	0.20
R8277:Plxna1	UTSW	6	89357180	missense	probably damaging	1.00
R8782:Plxna1	UTSW	6	89323238	missense	probably damaging	1.00
R8867:Plxna1	UTSW	6	89333097	missense	probably benign	0.00
R9245:Plxna1	UTSW	6	89337338	missense	probably damaging	1.00
R9253:Plxna1	UTSW	6	89357540	nonsense	probably null
R9269:Plxna1	UTSW	6	89329559	missense	probably null	1.00
R9273:Plxna1	UTSW	6	89319382	missense	possibly damaging	0.77
R9281:Plxna1	UTSW	6	89323331	missense	probably damaging	1.00
R9368:Plxna1	UTSW	6	89337156	missense	probably benign
R9440:Plxna1	UTSW	6	89341930	missense	probably benign	0.00
R9526:Plxna1	UTSW	6	89342651	missense	probably benign
R9601:Plxna1	UTSW	6	89331271	missense	probably damaging	1.00
R9714:Plxna1	UTSW	6	89319458	missense	probably damaging	0.99
R9782:Plxna1	UTSW	6	89356835	missense	probably benign	0.01
S24628:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
V8831:Plxna1	UTSW	6	89357137	missense	probably damaging	0.99
Z1176:Plxna1	UTSW	6	89321052	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTCTCACCGAGGAGTTCTG -3'
(R):5'- AGTAAAAGGCTAGCCCCGTG -3'

Sequencing Primer
(F):5'- AGGAGTTCTGGCACTGCAG -3'
(R):5'- CGTGCAGCCACATCCTG -3'

Posted On

2015-02-18