Incidental Mutation 'R3522:Txnrd3'
ID267540
Institutional Source Beutler Lab
Gene Symbol Txnrd3
Ensembl Gene ENSMUSG00000000811
Gene Namethioredoxin reductase 3
SynonymsTgr, TR2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location89643988-89675529 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 89663075 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000828] [ENSMUST00000000828] [ENSMUST00000101171]
Predicted Effect probably null
Transcript: ENSMUST00000000828
SMART Domains Protein: ENSMUSP00000000828
Gene: ENSMUSG00000000811

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Glutaredoxin 40 102 9.2e-18 PFAM
Pfam:Pyr_redox_2 129 466 2.5e-66 PFAM
Pfam:FAD_binding_2 130 290 4.6e-9 PFAM
Pfam:Pyr_redox 309 386 9.6e-16 PFAM
Pfam:Pyr_redox_dim 486 599 2.7e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000000828
SMART Domains Protein: ENSMUSP00000000828
Gene: ENSMUSG00000000811

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Glutaredoxin 40 102 9.2e-18 PFAM
Pfam:Pyr_redox_2 129 466 2.5e-66 PFAM
Pfam:FAD_binding_2 130 290 4.6e-9 PFAM
Pfam:Pyr_redox 309 386 9.6e-16 PFAM
Pfam:Pyr_redox_dim 486 599 2.7e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101171
SMART Domains Protein: ENSMUSP00000098730
Gene: ENSMUSG00000000811

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Glutaredoxin 40 102 1.5e-18 PFAM
Pfam:Thi4 116 222 3.9e-7 PFAM
Pfam:FAD_binding_2 130 264 3.7e-9 PFAM
Pfam:Pyr_redox_2 130 342 2.9e-24 PFAM
Pfam:Pyr_redox_dim 372 485 2.8e-31 PFAM
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a member of the family of pyridine nucleotide oxidoreductases. This protein catalyzes the reduction of thioredoxin, but unlike other mammalian thioredoxin reductases (TRs), it contains an additional glutaredoxin domain, and shows highest expression in testes. Like other TRs, it contains a C-terminal, penultimate selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for the use of a non-AUG (CUG) translation initiation site upstream of, and in-frame with the first AUG, leading to additional isoforms. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Txnrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Txnrd3 APN 6 89654147 missense probably benign 0.15
IGL01763:Txnrd3 APN 6 89661555 missense probably damaging 0.97
IGL02159:Txnrd3 APN 6 89669324 missense probably damaging 1.00
IGL02238:Txnrd3 APN 6 89656135 missense probably benign 0.02
IGL02452:Txnrd3 APN 6 89674795 makesense probably null
R1054:Txnrd3 UTSW 6 89650561 nonsense probably null
R5108:Txnrd3 UTSW 6 89673034 missense probably benign 0.33
R5653:Txnrd3 UTSW 6 89654085 missense probably benign 0.25
R6159:Txnrd3 UTSW 6 89663194 critical splice donor site probably null
R6246:Txnrd3 UTSW 6 89651541 missense probably benign 0.01
R6519:Txnrd3 UTSW 6 89654423 critical splice donor site probably null
R6661:Txnrd3 UTSW 6 89654152 nonsense probably null
R6685:Txnrd3 UTSW 6 89669915 missense possibly damaging 0.84
R7353:Txnrd3 UTSW 6 89661585 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGTTTGTACTCACCACCTCAC -3'
(R):5'- CATGCTATGCAACAGGGAAC -3'

Sequencing Primer
(F):5'- TGTACTCACCACCTCACCCCTAG -3'
(R):5'- GACATGGTCCATTCACTC -3'
Posted On2015-02-18