Mutagenetix > Incidental Mutation

Incidental Mutation 'R3522:Arhgef10'

267548

Institutional Source

Beutler Lab

Gene Symbol

Arhgef10

Ensembl Gene

ENSMUSG00000071176

Gene Name

Rho guanine nucleotide exchange factor (GEF) 10

Synonyms

6430549H08Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3522 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14911663-15001085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14954918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 150 (F150S)

Ref Sequence

ENSEMBL: ENSMUSP00000125526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000161162] [ENSMUST00000163062]

AlphaFold

Q8C033

Predicted Effect

probably damaging
Transcript: ENSMUST00000084207
AA Change: F478S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: F478S

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
coiled coil region	308	335	N/A	INTRINSIC
RhoGEF	401	583	9.79e-58	SMART
Blast:PH	617	829	6e-47	BLAST
low complexity region	1256	1272	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110800
AA Change: F439S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: F439S

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
RhoGEF	362	544	9.79e-58	SMART
Blast:PH	578	790	8e-47	BLAST
low complexity region	1217	1233	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161162
AA Change: F477S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125606
Gene: ENSMUSG00000071176
AA Change: F477S

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
low complexity region	246	264	N/A	INTRINSIC
coiled coil region	307	334	N/A	INTRINSIC
RhoGEF	400	579	2.2e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163062
AA Change: F150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: F150S

Domain	Start	End	E-Value	Type
RhoGEF	73	255	9.79e-58	SMART
Blast:PH	289	501	2e-47	BLAST
low complexity region	899	915	N/A	INTRINSIC

Meta Mutation Damage Score

0.9340

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,549,626		probably null	Het
Ankrd35	A	G	3: 96,685,062	E888G	probably damaging	Het
Atp10d	G	T	5: 72,239,157	R235L	probably benign	Het
Cacna1b	A	G	2: 24,763,043	V2A	possibly damaging	Het
Cand1	A	T	10: 119,239,197	L15Q	probably benign	Het
Cavin3	C	A	7: 105,481,143	G154V	probably benign	Het
Ccdc73	A	T	2: 104,991,485	D593V	probably damaging	Het
Cdk5rap2	T	C	4: 70,250,410	K161E	probably damaging	Het
Chil4	A	T	3: 106,203,740	N279K	probably benign	Het
Chst13	T	G	6: 90,318,263	D56A	probably damaging	Het
Cnn1	C	A	9: 22,099,368	H5N	probably benign	Het
Cpsf4l	T	A	11: 113,702,493	K88N	probably damaging	Het
Ctnnbl1	G	T	2: 157,871,193		probably null	Het
Dnah7a	A	C	1: 53,618,116	F834V	probably damaging	Het
Fbxo41	A	G	6: 85,484,181	S182P	probably benign	Het
Fkbp5	T	C	17: 28,415,996	T180A	probably benign	Het
Flg2	T	A	3: 93,220,027	I2082N	unknown	Het
Gm4968	A	G	6: 127,233,762		noncoding transcript	Het
Gpc5	T	A	14: 116,524,335	H612Q	probably benign	Het
Gsg1	A	T	6: 135,241,253	V212D	probably damaging	Het
Hipk1	A	G	3: 103,744,114	V1111A	probably damaging	Het
Hormad1	A	T	3: 95,576,285	Q136L	probably benign	Het
Ifi35	T	A	11: 101,457,685	S147R	probably benign	Het
Iqgap3	C	T	3: 88,090,782	A282V	probably null	Het
Jmy	T	C	13: 93,454,050	D515G	probably damaging	Het
Kctd10	G	A	5: 114,374,923	R64C	probably damaging	Het
Kidins220	T	C	12: 24,990,758	V121A	probably damaging	Het
Lcn3	G	A	2: 25,766,121	V63M	possibly damaging	Het
Lmx1b	T	A	2: 33,639,531	Y72F	probably benign	Het
Lrp1	T	C	10: 127,553,555	D3164G	probably damaging	Het
Mdh1b	C	T	1: 63,719,768	V222M	probably damaging	Het
Mst1	T	C	9: 108,081,503		probably benign	Het
Myo7b	C	A	18: 32,010,079	V189F	probably damaging	Het
Ndc1	T	C	4: 107,393,158	S533P	probably damaging	Het
Ndrg3	T	C	2: 156,944,027	D164G	probably damaging	Het
Nol11	C	T	11: 107,173,628	C500Y	possibly damaging	Het
Nsd3	A	G	8: 25,706,614	N1208D	probably benign	Het
Nup155	C	T	15: 8,156,678		probably benign	Het
Olfr768	A	G	10: 129,093,842	I44T	possibly damaging	Het
Olfr911-ps1	A	G	9: 38,523,785	T18A	probably damaging	Het
Olfr921	A	T	9: 38,775,720	D155V	possibly damaging	Het
Olfr988	A	T	2: 85,353,003	C308S	probably benign	Het
Phf3	A	G	1: 30,805,603	L1425P	probably damaging	Het
Pla2r1	A	G	2: 60,448,906	Y777H	probably damaging	Het
Pld1	A	G	3: 28,031,247	E184G	probably damaging	Het
Plxna1	T	C	6: 89,337,353		probably null	Het
Ptgfrn	T	C	3: 101,043,402	E865G	probably damaging	Het
Ptpn13	G	T	5: 103,589,854		probably benign	Het
Pygb	G	T	2: 150,828,553	V763F	probably benign	Het
Ros1	A	C	10: 52,090,995	Y1705*	probably null	Het
Sec61a2	A	G	2: 5,893,216	F5L	probably benign	Het
Skint5	A	G	4: 113,756,905		probably null	Het
Sntg2	A	G	12: 30,312,567	V60A	probably damaging	Het
Sppl2a	A	G	2: 126,920,322	C280R	possibly damaging	Het
Srrm4	A	C	5: 116,446,544	M1R	probably null	Het
Sult1c1	T	C	17: 53,972,015	E91G	probably damaging	Het
Themis2	C	G	4: 132,785,595	R440P	probably damaging	Het
Tmem229a	A	G	6: 24,955,059	L232P	probably benign	Het
Trappc1	T	C	11: 69,324,422	F43L	probably damaging	Het
Trappc11	A	T	8: 47,498,673	Y982N	possibly damaging	Het
Trpv6	A	T	6: 41,627,405	M139K	probably damaging	Het
Txnrd3	A	G	6: 89,663,075		probably null	Het
Vmn1r184	T	A	7: 26,267,583	Y251*	probably null	Het
Vmn1r216	A	G	13: 23,099,374	N76D	possibly damaging	Het
Vmn1r71	C	A	7: 10,747,865	V233F	probably benign	Het
Vps13a	A	C	19: 16,766,493		probably benign	Het
Vwa5b2	A	G	16: 20,601,608	S756G	probably damaging	Het
Wdr36	T	A	18: 32,861,485		probably null	Het
Wdr86	A	G	5: 24,718,307	V129A	probably benign	Het
Zfyve9	A	G	4: 108,719,743	L47S	probably benign	Het

Other mutations in Arhgef10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arhgef10	APN	8	14975006	missense	probably damaging	1.00
IGL00823:Arhgef10	APN	8	14940378	unclassified	probably benign
IGL01012:Arhgef10	APN	8	14979977	missense	probably damaging	0.99
IGL01311:Arhgef10	APN	8	14991054	splice site	probably null
IGL01596:Arhgef10	APN	8	14999468	nonsense	probably null
IGL01888:Arhgef10	APN	8	14962577	nonsense	probably null
IGL01938:Arhgef10	APN	8	14991062	missense	probably benign	0.09
IGL02151:Arhgef10	APN	8	14928889	missense	possibly damaging	0.77
IGL02274:Arhgef10	APN	8	14947205	missense	probably damaging	0.99
IGL02369:Arhgef10	APN	8	14997551	missense	probably damaging	1.00
IGL02411:Arhgef10	APN	8	14954819	missense	probably benign	0.01
IGL02500:Arhgef10	APN	8	14961238	missense	probably damaging	1.00
IGL02597:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02602:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02743:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02744:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL03113:Arhgef10	APN	8	14954505	missense	probably damaging	1.00
IGL03248:Arhgef10	APN	8	14928847	missense	probably benign	0.00
P0028:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
P4748:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
R0049:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R0197:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0479:Arhgef10	UTSW	8	14991070	missense	probably damaging	0.98
R0701:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0966:Arhgef10	UTSW	8	14940343	missense	probably benign	0.01
R1367:Arhgef10	UTSW	8	14940225	missense	probably damaging	1.00
R1572:Arhgef10	UTSW	8	14991211	missense	possibly damaging	0.53
R1631:Arhgef10	UTSW	8	14947157	missense	probably damaging	0.98
R1766:Arhgef10	UTSW	8	14979836	missense	probably damaging	1.00
R1920:Arhgef10	UTSW	8	14956987	splice site	probably benign
R2051:Arhgef10	UTSW	8	14945320	missense	probably null	1.00
R2088:Arhgef10	UTSW	8	14983898	missense	possibly damaging	0.46
R2118:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2120:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2121:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2122:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2124:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2318:Arhgef10	UTSW	8	14928855	missense	probably damaging	1.00
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2874:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2874:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R4049:Arhgef10	UTSW	8	14979998	missense	probably benign	0.05
R4324:Arhgef10	UTSW	8	14940335	missense	possibly damaging	0.77
R4351:Arhgef10	UTSW	8	14991145	nonsense	probably null
R4384:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4385:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4685:Arhgef10	UTSW	8	14956963	missense	probably damaging	1.00
R5111:Arhgef10	UTSW	8	14932408	missense	probably benign	0.00
R5169:Arhgef10	UTSW	8	14930051	missense	possibly damaging	0.80
R5670:Arhgef10	UTSW	8	14954774	missense	probably benign	0.01
R5945:Arhgef10	UTSW	8	14980028	critical splice donor site	probably null
R6593:Arhgef10	UTSW	8	14962522	missense	probably damaging	1.00
R6593:Arhgef10	UTSW	8	14962564	missense	possibly damaging	0.82
R6734:Arhgef10	UTSW	8	14975053	missense	probably damaging	1.00
R6859:Arhgef10	UTSW	8	14975005	missense	probably damaging	1.00
R6890:Arhgef10	UTSW	8	14928786	missense	probably benign	0.27
R7068:Arhgef10	UTSW	8	14958639	missense	probably damaging	1.00
R7081:Arhgef10	UTSW	8	14997547	nonsense	probably null
R7157:Arhgef10	UTSW	8	14930030	missense	probably damaging	1.00
R7232:Arhgef10	UTSW	8	14940323	missense	probably benign	0.10
R7514:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R7544:Arhgef10	UTSW	8	14979854	missense	probably benign	0.34
R7657:Arhgef10	UTSW	8	14979893	missense	probably damaging	1.00
R7736:Arhgef10	UTSW	8	14980583	nonsense	probably null
R7777:Arhgef10	UTSW	8	14945373	missense	probably damaging	1.00
R8000:Arhgef10	UTSW	8	14930054	missense	probably damaging	1.00
R8060:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R8441:Arhgef10	UTSW	8	14991237	splice site	probably benign
R8545:Arhgef10	UTSW	8	14928868	missense	probably benign	0.00
R8545:Arhgef10	UTSW	8	14975931	missense	possibly damaging	0.83
R8702:Arhgef10	UTSW	8	14942638	missense	probably benign
R8846:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R8854:Arhgef10	UTSW	8	14979798	critical splice acceptor site	probably null
R9076:Arhgef10	UTSW	8	14974993	missense	probably damaging	1.00
R9384:Arhgef10	UTSW	8	14991067	missense	probably damaging	0.99
R9479:Arhgef10	UTSW	8	14997632	missense	probably damaging	1.00
R9799:Arhgef10	UTSW	8	14940268	missense	probably damaging	0.99
X0024:Arhgef10	UTSW	8	14978486	missense	probably benign	0.01
X0027:Arhgef10	UTSW	8	14997631	missense	possibly damaging	0.92
Z1088:Arhgef10	UTSW	8	14964191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGACACTTGTTTCTGGCGCAG -3'
(R):5'- CTTCCTTGTCCCCTGAGAAAG -3'

Sequencing Primer
(F):5'- GCAATATGAGAAGCCGCTGTCTG -3'
(R):5'- GACCCCTGCTCCTTTCCTGAAG -3'

Posted On

2015-02-18