Incidental Mutation 'R3522:Nsd3'
ID 267549
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Name nuclear receptor binding SET domain protein 3
Synonyms Whsc1l1, WHISTLE
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.361) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 26091617-26209694 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26196642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1208 (N1208D)
Ref Sequence ENSEMBL: ENSMUSP00000117778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000153597]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000084026
AA Change: N1208D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: N1208D

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129959
Predicted Effect probably benign
Transcript: ENSMUST00000139966
AA Change: N1159D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: N1159D

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142395
AA Change: N1208D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: N1208D

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153597
SMART Domains Protein: ENSMUSP00000123028
Gene: ENSMUSG00000054823

DomainStartEndE-ValueType
PWWP 17 79 8.62e-18 SMART
AWS 152 203 2.61e-17 SMART
SET 204 327 2.17e-41 SMART
PostSET 328 344 2.63e-3 SMART
low complexity region 358 375 N/A INTRINSIC
PHD 381 424 4.32e-9 SMART
Meta Mutation Damage Score 0.1893 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,592,378 (GRCm39) E888G probably damaging Het
Arhgef10 T C 8: 15,004,918 (GRCm39) F150S probably damaging Het
Atp10d G T 5: 72,396,500 (GRCm39) R235L probably benign Het
Cacna1b A G 2: 24,653,055 (GRCm39) V2A possibly damaging Het
Cand1 A T 10: 119,075,102 (GRCm39) L15Q probably benign Het
Cavin3 C A 7: 105,130,350 (GRCm39) G154V probably benign Het
Ccdc73 A T 2: 104,821,830 (GRCm39) D593V probably damaging Het
Cdk5rap2 T C 4: 70,168,647 (GRCm39) K161E probably damaging Het
Chil4 A T 3: 106,111,056 (GRCm39) N279K probably benign Het
Chst13 T G 6: 90,295,245 (GRCm39) D56A probably damaging Het
Cnn1 C A 9: 22,010,664 (GRCm39) H5N probably benign Het
Cpsf4l T A 11: 113,593,319 (GRCm39) K88N probably damaging Het
Ctnnbl1 G T 2: 157,713,113 (GRCm39) probably null Het
Dnah7a A C 1: 53,657,275 (GRCm39) F834V probably damaging Het
Fbxo41 A G 6: 85,461,163 (GRCm39) S182P probably benign Het
Fkbp5 T C 17: 28,634,970 (GRCm39) T180A probably benign Het
Flg2 T A 3: 93,127,334 (GRCm39) I2082N unknown Het
Gm4968 A G 6: 127,210,725 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 116,761,747 (GRCm39) H612Q probably benign Het
Gsg1 A T 6: 135,218,251 (GRCm39) V212D probably damaging Het
Hipk1 A G 3: 103,651,430 (GRCm39) V1111A probably damaging Het
Hormad1 A T 3: 95,483,596 (GRCm39) Q136L probably benign Het
Ifi35 T A 11: 101,348,511 (GRCm39) S147R probably benign Het
Iqca1l A G 5: 24,754,624 (GRCm39) probably null Het
Iqgap3 C T 3: 87,998,089 (GRCm39) A282V probably null Het
Jmy T C 13: 93,590,558 (GRCm39) D515G probably damaging Het
Kctd10 G A 5: 114,512,984 (GRCm39) R64C probably damaging Het
Kidins220 T C 12: 25,040,757 (GRCm39) V121A probably damaging Het
Lcn3 G A 2: 25,656,133 (GRCm39) V63M possibly damaging Het
Lmx1b T A 2: 33,529,543 (GRCm39) Y72F probably benign Het
Lrp1 T C 10: 127,389,424 (GRCm39) D3164G probably damaging Het
Mdh1b C T 1: 63,758,927 (GRCm39) V222M probably damaging Het
Mst1 T C 9: 107,958,702 (GRCm39) probably benign Het
Myo7b C A 18: 32,143,132 (GRCm39) V189F probably damaging Het
Ndc1 T C 4: 107,250,355 (GRCm39) S533P probably damaging Het
Ndrg3 T C 2: 156,785,947 (GRCm39) D164G probably damaging Het
Nol11 C T 11: 107,064,454 (GRCm39) C500Y possibly damaging Het
Nup155 C T 15: 8,186,162 (GRCm39) probably benign Het
Or5ak20 A T 2: 85,183,347 (GRCm39) C308S probably benign Het
Or6c38 A G 10: 128,929,711 (GRCm39) I44T possibly damaging Het
Or8b47 A G 9: 38,435,081 (GRCm39) T18A probably damaging Het
Or8b54 A T 9: 38,687,016 (GRCm39) D155V possibly damaging Het
Phf3 A G 1: 30,844,684 (GRCm39) L1425P probably damaging Het
Pla2r1 A G 2: 60,279,250 (GRCm39) Y777H probably damaging Het
Pld1 A G 3: 28,085,396 (GRCm39) E184G probably damaging Het
Plxna1 T C 6: 89,314,335 (GRCm39) probably null Het
Ptgfrn T C 3: 100,950,718 (GRCm39) E865G probably damaging Het
Ptpn13 G T 5: 103,737,720 (GRCm39) probably benign Het
Pygb G T 2: 150,670,473 (GRCm39) V763F probably benign Het
Ros1 A C 10: 51,967,091 (GRCm39) Y1705* probably null Het
Sec61a2 A G 2: 5,898,027 (GRCm39) F5L probably benign Het
Skint5 A G 4: 113,614,102 (GRCm39) probably null Het
Sntg2 A G 12: 30,362,566 (GRCm39) V60A probably damaging Het
Sppl2a A G 2: 126,762,242 (GRCm39) C280R possibly damaging Het
Srrm4 A C 5: 116,584,603 (GRCm39) M1R probably null Het
Sult1c2 T C 17: 54,279,043 (GRCm39) E91G probably damaging Het
Themis2 C G 4: 132,512,906 (GRCm39) R440P probably damaging Het
Tmem229a A G 6: 24,955,058 (GRCm39) L232P probably benign Het
Trappc1 T C 11: 69,215,248 (GRCm39) F43L probably damaging Het
Trappc11 A T 8: 47,951,708 (GRCm39) Y982N possibly damaging Het
Trpv6 A T 6: 41,604,339 (GRCm39) M139K probably damaging Het
Txnrd3 A G 6: 89,640,057 (GRCm39) probably null Het
Vmn1r184 T A 7: 25,967,008 (GRCm39) Y251* probably null Het
Vmn1r216 A G 13: 23,283,544 (GRCm39) N76D possibly damaging Het
Vmn1r71 C A 7: 10,481,792 (GRCm39) V233F probably benign Het
Vps13a A C 19: 16,743,857 (GRCm39) probably benign Het
Vwa5b2 A G 16: 20,420,358 (GRCm39) S756G probably damaging Het
Wdr36 T A 18: 32,994,538 (GRCm39) probably null Het
Wdr86 A G 5: 24,923,305 (GRCm39) V129A probably benign Het
Zfyve9 A G 4: 108,576,940 (GRCm39) L47S probably benign Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 26,166,728 (GRCm39) missense probably benign 0.40
IGL00718:Nsd3 APN 8 26,196,562 (GRCm39) missense probably damaging 0.97
IGL00727:Nsd3 APN 8 26,131,174 (GRCm39) missense probably damaging 1.00
IGL01324:Nsd3 APN 8 26,152,836 (GRCm39) missense probably damaging 1.00
IGL01614:Nsd3 APN 8 26,156,095 (GRCm39) missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 26,130,668 (GRCm39) missense probably damaging 1.00
IGL02066:Nsd3 APN 8 26,203,515 (GRCm39) missense probably damaging 1.00
IGL02229:Nsd3 APN 8 26,200,775 (GRCm39) missense probably damaging 0.98
IGL02481:Nsd3 APN 8 26,181,143 (GRCm39) missense probably damaging 1.00
IGL02686:Nsd3 APN 8 26,156,086 (GRCm39) missense probably damaging 0.96
IGL03394:Nsd3 APN 8 26,165,765 (GRCm39) splice site probably benign
Pine UTSW 8 26,169,952 (GRCm39) missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 26,203,572 (GRCm39) missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 26,130,922 (GRCm39) missense probably damaging 1.00
R0136:Nsd3 UTSW 8 26,149,870 (GRCm39) nonsense probably null
R0195:Nsd3 UTSW 8 26,170,709 (GRCm39) missense probably damaging 1.00
R0207:Nsd3 UTSW 8 26,173,273 (GRCm39) missense probably benign 0.02
R0471:Nsd3 UTSW 8 26,138,450 (GRCm39) splice site probably benign
R0511:Nsd3 UTSW 8 26,168,732 (GRCm39) missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 26,190,605 (GRCm39) missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 26,200,718 (GRCm39) missense probably damaging 1.00
R0589:Nsd3 UTSW 8 26,131,303 (GRCm39) missense probably damaging 1.00
R0645:Nsd3 UTSW 8 26,199,096 (GRCm39) missense probably benign 0.08
R0664:Nsd3 UTSW 8 26,204,267 (GRCm39) missense probably damaging 0.97
R0738:Nsd3 UTSW 8 26,168,725 (GRCm39) splice site probably null
R1148:Nsd3 UTSW 8 26,203,407 (GRCm39) missense probably benign 0.09
R1148:Nsd3 UTSW 8 26,203,407 (GRCm39) missense probably benign 0.09
R1265:Nsd3 UTSW 8 26,172,578 (GRCm39) missense probably benign
R1298:Nsd3 UTSW 8 26,169,952 (GRCm39) missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 26,190,594 (GRCm39) missense probably damaging 1.00
R1493:Nsd3 UTSW 8 26,203,407 (GRCm39) missense probably benign 0.09
R1528:Nsd3 UTSW 8 26,188,795 (GRCm39) missense probably damaging 1.00
R2051:Nsd3 UTSW 8 26,181,116 (GRCm39) missense probably damaging 0.99
R2199:Nsd3 UTSW 8 26,156,073 (GRCm39) missense probably damaging 0.99
R3414:Nsd3 UTSW 8 26,190,047 (GRCm39) missense probably damaging 1.00
R3623:Nsd3 UTSW 8 26,152,835 (GRCm39) missense probably damaging 0.98
R3624:Nsd3 UTSW 8 26,152,835 (GRCm39) missense probably damaging 0.98
R3798:Nsd3 UTSW 8 26,188,873 (GRCm39) missense probably damaging 1.00
R4345:Nsd3 UTSW 8 26,131,333 (GRCm39) missense probably benign 0.04
R4370:Nsd3 UTSW 8 26,138,524 (GRCm39) missense probably benign 0.13
R4421:Nsd3 UTSW 8 26,131,288 (GRCm39) missense probably damaging 0.99
R4583:Nsd3 UTSW 8 26,200,703 (GRCm39) missense probably benign 0.20
R4664:Nsd3 UTSW 8 26,188,894 (GRCm39) missense probably damaging 1.00
R4741:Nsd3 UTSW 8 26,163,382 (GRCm39) missense probably damaging 1.00
R4876:Nsd3 UTSW 8 26,181,161 (GRCm39) missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 26,188,939 (GRCm39) missense probably damaging 1.00
R5000:Nsd3 UTSW 8 26,172,593 (GRCm39) missense probably damaging 1.00
R5132:Nsd3 UTSW 8 26,168,855 (GRCm39) missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 26,169,985 (GRCm39) missense probably benign 0.00
R5760:Nsd3 UTSW 8 26,149,772 (GRCm39) missense probably damaging 1.00
R5778:Nsd3 UTSW 8 26,149,834 (GRCm39) missense probably damaging 1.00
R5779:Nsd3 UTSW 8 26,172,685 (GRCm39) nonsense probably null
R5860:Nsd3 UTSW 8 26,156,107 (GRCm39) missense probably damaging 0.98
R5911:Nsd3 UTSW 8 26,156,092 (GRCm39) missense probably damaging 1.00
R6168:Nsd3 UTSW 8 26,181,188 (GRCm39) missense probably null 1.00
R6467:Nsd3 UTSW 8 26,130,646 (GRCm39) missense probably damaging 1.00
R6490:Nsd3 UTSW 8 26,204,212 (GRCm39) missense probably damaging 1.00
R6519:Nsd3 UTSW 8 26,152,955 (GRCm39) missense probably damaging 1.00
R6554:Nsd3 UTSW 8 26,152,891 (GRCm39) missense probably damaging 0.99
R7038:Nsd3 UTSW 8 26,131,279 (GRCm39) missense probably damaging 1.00
R7088:Nsd3 UTSW 8 26,156,050 (GRCm39) missense probably benign 0.40
R7244:Nsd3 UTSW 8 26,156,055 (GRCm39) missense probably damaging 0.96
R7308:Nsd3 UTSW 8 26,130,740 (GRCm39) missense probably damaging 1.00
R7678:Nsd3 UTSW 8 26,149,833 (GRCm39) missense possibly damaging 0.82
R7717:Nsd3 UTSW 8 26,172,578 (GRCm39) missense probably benign
R8064:Nsd3 UTSW 8 26,190,698 (GRCm39) nonsense probably null
R8242:Nsd3 UTSW 8 26,196,567 (GRCm39) nonsense probably null
R8312:Nsd3 UTSW 8 26,153,268 (GRCm39) missense probably damaging 1.00
R8547:Nsd3 UTSW 8 26,184,811 (GRCm39) missense probably damaging 1.00
R8954:Nsd3 UTSW 8 26,163,394 (GRCm39) missense probably damaging 1.00
R8995:Nsd3 UTSW 8 26,131,169 (GRCm39) missense probably damaging 1.00
R9026:Nsd3 UTSW 8 26,172,576 (GRCm39) missense probably benign 0.10
R9281:Nsd3 UTSW 8 26,152,961 (GRCm39) missense probably benign 0.00
R9320:Nsd3 UTSW 8 26,199,088 (GRCm39) critical splice acceptor site probably null
R9563:Nsd3 UTSW 8 26,204,230 (GRCm39) missense
R9703:Nsd3 UTSW 8 26,131,228 (GRCm39) missense probably benign 0.00
X0026:Nsd3 UTSW 8 26,190,621 (GRCm39) missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 26,131,018 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACACTCAGGTTACGCACTG -3'
(R):5'- CGGTTCCTTCTGTAATCCTGAG -3'

Sequencing Primer
(F):5'- TAAGATCTCATGGGTCCAAGC -3'
(R):5'- TGTAATCCTGAGATAATAACAGCACC -3'
Posted On 2015-02-18