Incidental Mutation 'R3522:Or8b47'
ID 267552
Institutional Source Beutler Lab
Gene Symbol Or8b47
Ensembl Gene ENSMUSG00000062621
Gene Name olfactory receptor family 8 subfamily B member 47
Synonyms GA_x6K02T2PVTD-32247224-32248163, Olfr911, MOR165-1, GA_x6K02T2PVTD-32223906-32224841, Olfr909, MOR166-1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 38435026-38435965 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38435081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 18 (T18A)
Ref Sequence ENSEMBL: ENSMUSP00000150446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074987] [ENSMUST00000216496]
AlphaFold A0A140T8K0
Predicted Effect probably damaging
Transcript: ENSMUST00000074987
AA Change: T18A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074515
Gene: ENSMUSG00000062621
AA Change: T18A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 9.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216496
AA Change: T18A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,592,378 (GRCm39) E888G probably damaging Het
Arhgef10 T C 8: 15,004,918 (GRCm39) F150S probably damaging Het
Atp10d G T 5: 72,396,500 (GRCm39) R235L probably benign Het
Cacna1b A G 2: 24,653,055 (GRCm39) V2A possibly damaging Het
Cand1 A T 10: 119,075,102 (GRCm39) L15Q probably benign Het
Cavin3 C A 7: 105,130,350 (GRCm39) G154V probably benign Het
Ccdc73 A T 2: 104,821,830 (GRCm39) D593V probably damaging Het
Cdk5rap2 T C 4: 70,168,647 (GRCm39) K161E probably damaging Het
Chil4 A T 3: 106,111,056 (GRCm39) N279K probably benign Het
Chst13 T G 6: 90,295,245 (GRCm39) D56A probably damaging Het
Cnn1 C A 9: 22,010,664 (GRCm39) H5N probably benign Het
Cpsf4l T A 11: 113,593,319 (GRCm39) K88N probably damaging Het
Ctnnbl1 G T 2: 157,713,113 (GRCm39) probably null Het
Dnah7a A C 1: 53,657,275 (GRCm39) F834V probably damaging Het
Fbxo41 A G 6: 85,461,163 (GRCm39) S182P probably benign Het
Fkbp5 T C 17: 28,634,970 (GRCm39) T180A probably benign Het
Flg2 T A 3: 93,127,334 (GRCm39) I2082N unknown Het
Gm4968 A G 6: 127,210,725 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 116,761,747 (GRCm39) H612Q probably benign Het
Gsg1 A T 6: 135,218,251 (GRCm39) V212D probably damaging Het
Hipk1 A G 3: 103,651,430 (GRCm39) V1111A probably damaging Het
Hormad1 A T 3: 95,483,596 (GRCm39) Q136L probably benign Het
Ifi35 T A 11: 101,348,511 (GRCm39) S147R probably benign Het
Iqca1l A G 5: 24,754,624 (GRCm39) probably null Het
Iqgap3 C T 3: 87,998,089 (GRCm39) A282V probably null Het
Jmy T C 13: 93,590,558 (GRCm39) D515G probably damaging Het
Kctd10 G A 5: 114,512,984 (GRCm39) R64C probably damaging Het
Kidins220 T C 12: 25,040,757 (GRCm39) V121A probably damaging Het
Lcn3 G A 2: 25,656,133 (GRCm39) V63M possibly damaging Het
Lmx1b T A 2: 33,529,543 (GRCm39) Y72F probably benign Het
Lrp1 T C 10: 127,389,424 (GRCm39) D3164G probably damaging Het
Mdh1b C T 1: 63,758,927 (GRCm39) V222M probably damaging Het
Mst1 T C 9: 107,958,702 (GRCm39) probably benign Het
Myo7b C A 18: 32,143,132 (GRCm39) V189F probably damaging Het
Ndc1 T C 4: 107,250,355 (GRCm39) S533P probably damaging Het
Ndrg3 T C 2: 156,785,947 (GRCm39) D164G probably damaging Het
Nol11 C T 11: 107,064,454 (GRCm39) C500Y possibly damaging Het
Nsd3 A G 8: 26,196,642 (GRCm39) N1208D probably benign Het
Nup155 C T 15: 8,186,162 (GRCm39) probably benign Het
Or5ak20 A T 2: 85,183,347 (GRCm39) C308S probably benign Het
Or6c38 A G 10: 128,929,711 (GRCm39) I44T possibly damaging Het
Or8b54 A T 9: 38,687,016 (GRCm39) D155V possibly damaging Het
Phf3 A G 1: 30,844,684 (GRCm39) L1425P probably damaging Het
Pla2r1 A G 2: 60,279,250 (GRCm39) Y777H probably damaging Het
Pld1 A G 3: 28,085,396 (GRCm39) E184G probably damaging Het
Plxna1 T C 6: 89,314,335 (GRCm39) probably null Het
Ptgfrn T C 3: 100,950,718 (GRCm39) E865G probably damaging Het
Ptpn13 G T 5: 103,737,720 (GRCm39) probably benign Het
Pygb G T 2: 150,670,473 (GRCm39) V763F probably benign Het
Ros1 A C 10: 51,967,091 (GRCm39) Y1705* probably null Het
Sec61a2 A G 2: 5,898,027 (GRCm39) F5L probably benign Het
Skint5 A G 4: 113,614,102 (GRCm39) probably null Het
Sntg2 A G 12: 30,362,566 (GRCm39) V60A probably damaging Het
Sppl2a A G 2: 126,762,242 (GRCm39) C280R possibly damaging Het
Srrm4 A C 5: 116,584,603 (GRCm39) M1R probably null Het
Sult1c2 T C 17: 54,279,043 (GRCm39) E91G probably damaging Het
Themis2 C G 4: 132,512,906 (GRCm39) R440P probably damaging Het
Tmem229a A G 6: 24,955,058 (GRCm39) L232P probably benign Het
Trappc1 T C 11: 69,215,248 (GRCm39) F43L probably damaging Het
Trappc11 A T 8: 47,951,708 (GRCm39) Y982N possibly damaging Het
Trpv6 A T 6: 41,604,339 (GRCm39) M139K probably damaging Het
Txnrd3 A G 6: 89,640,057 (GRCm39) probably null Het
Vmn1r184 T A 7: 25,967,008 (GRCm39) Y251* probably null Het
Vmn1r216 A G 13: 23,283,544 (GRCm39) N76D possibly damaging Het
Vmn1r71 C A 7: 10,481,792 (GRCm39) V233F probably benign Het
Vps13a A C 19: 16,743,857 (GRCm39) probably benign Het
Vwa5b2 A G 16: 20,420,358 (GRCm39) S756G probably damaging Het
Wdr36 T A 18: 32,994,538 (GRCm39) probably null Het
Wdr86 A G 5: 24,923,305 (GRCm39) V129A probably benign Het
Zfyve9 A G 4: 108,576,940 (GRCm39) L47S probably benign Het
Other mutations in Or8b47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Or8b47 APN 9 38,435,029 (GRCm39) utr 5 prime probably benign
IGL02319:Or8b47 APN 9 38,435,166 (GRCm39) missense probably damaging 0.97
IGL02415:Or8b47 APN 9 38,435,408 (GRCm39) missense probably benign 0.42
IGL02536:Or8b47 APN 9 38,435,460 (GRCm39) missense probably damaging 1.00
IGL02702:Or8b47 APN 9 38,435,856 (GRCm39) missense probably damaging 1.00
IGL02926:Or8b47 APN 9 38,435,021 (GRCm39) utr 5 prime probably benign
R0499:Or8b47 UTSW 9 38,435,801 (GRCm39) missense probably benign 0.01
R0662:Or8b47 UTSW 9 38,435,322 (GRCm39) missense probably damaging 0.99
R0799:Or8b47 UTSW 9 38,435,437 (GRCm39) missense probably benign 0.01
R1186:Or8b47 UTSW 9 38,435,453 (GRCm39) missense probably damaging 0.97
R1681:Or8b47 UTSW 9 38,435,413 (GRCm39) missense probably benign 0.03
R5820:Or8b47 UTSW 9 38,435,895 (GRCm39) missense possibly damaging 0.52
R6597:Or8b47 UTSW 9 38,435,300 (GRCm39) missense probably benign 0.00
R7721:Or8b47 UTSW 9 38,435,013 (GRCm39) critical splice acceptor site probably null
R7846:Or8b47 UTSW 9 38,435,675 (GRCm39) missense probably benign 0.00
R7985:Or8b47 UTSW 9 38,435,239 (GRCm39) missense probably damaging 1.00
R8339:Or8b47 UTSW 9 38,435,717 (GRCm39) missense probably damaging 1.00
R8460:Or8b47 UTSW 9 38,427,926 (GRCm39) unclassified probably benign
R9143:Or8b47 UTSW 9 38,427,917 (GRCm39) unclassified probably benign
R9287:Or8b47 UTSW 9 38,435,082 (GRCm39) missense probably damaging 1.00
Z1088:Or8b47 UTSW 9 38,435,155 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAATGGTAATTTCTGCTCACTC -3'
(R):5'- AAGTTCATCAGCATTTTGGGTG -3'

Sequencing Primer
(F):5'- TGCTCACTCAGATATTCTCATAGG -3'
(R):5'- CATCAGCATTTTGGGTGTAATTACAG -3'
Posted On 2015-02-18