Mutagenetix > Incidental Mutation

Incidental Mutation 'R3522:Olfr921'

267553

Institutional Source

Beutler Lab

Gene Symbol

Olfr921

Ensembl Gene

ENSMUSG00000049926

Gene Name

olfactory receptor 921

Synonyms

MOR165-8, GA_x6K02T2PVTD-32478047-32478988

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R3522 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38773068-38779021 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38775720 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 155 (D155V)

Ref Sequence

ENSEMBL: ENSMUSP00000150844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071681] [ENSMUST00000213958] [ENSMUST00000217114]

AlphaFold

Q7TRC0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062124
AA Change: D155V

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000051879
Gene: ENSMUSG00000049926
AA Change: D155V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.8e-48	PFAM
Pfam:7tm_1	41	290	6.3e-23	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071681
AA Change: D155V

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000071604
Gene: ENSMUSG00000049926
AA Change: D155V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	9.8e-51	PFAM
Pfam:7tm_1	41	290	1.3e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213958
AA Change: D155V

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217114
AA Change: D155V

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,549,626		probably null	Het
Ankrd35	A	G	3: 96,685,062	E888G	probably damaging	Het
Arhgef10	T	C	8: 14,954,918	F150S	probably damaging	Het
Atp10d	G	T	5: 72,239,157	R235L	probably benign	Het
Cacna1b	A	G	2: 24,763,043	V2A	possibly damaging	Het
Cand1	A	T	10: 119,239,197	L15Q	probably benign	Het
Cavin3	C	A	7: 105,481,143	G154V	probably benign	Het
Ccdc73	A	T	2: 104,991,485	D593V	probably damaging	Het
Cdk5rap2	T	C	4: 70,250,410	K161E	probably damaging	Het
Chil4	A	T	3: 106,203,740	N279K	probably benign	Het
Chst13	T	G	6: 90,318,263	D56A	probably damaging	Het
Cnn1	C	A	9: 22,099,368	H5N	probably benign	Het
Cpsf4l	T	A	11: 113,702,493	K88N	probably damaging	Het
Ctnnbl1	G	T	2: 157,871,193		probably null	Het
Dnah7a	A	C	1: 53,618,116	F834V	probably damaging	Het
Fbxo41	A	G	6: 85,484,181	S182P	probably benign	Het
Fkbp5	T	C	17: 28,415,996	T180A	probably benign	Het
Flg2	T	A	3: 93,220,027	I2082N	unknown	Het
Gm4968	A	G	6: 127,233,762		noncoding transcript	Het
Gpc5	T	A	14: 116,524,335	H612Q	probably benign	Het
Gsg1	A	T	6: 135,241,253	V212D	probably damaging	Het
Hipk1	A	G	3: 103,744,114	V1111A	probably damaging	Het
Hormad1	A	T	3: 95,576,285	Q136L	probably benign	Het
Ifi35	T	A	11: 101,457,685	S147R	probably benign	Het
Iqgap3	C	T	3: 88,090,782	A282V	probably null	Het
Jmy	T	C	13: 93,454,050	D515G	probably damaging	Het
Kctd10	G	A	5: 114,374,923	R64C	probably damaging	Het
Kidins220	T	C	12: 24,990,758	V121A	probably damaging	Het
Lcn3	G	A	2: 25,766,121	V63M	possibly damaging	Het
Lmx1b	T	A	2: 33,639,531	Y72F	probably benign	Het
Lrp1	T	C	10: 127,553,555	D3164G	probably damaging	Het
Mdh1b	C	T	1: 63,719,768	V222M	probably damaging	Het
Mst1	T	C	9: 108,081,503		probably benign	Het
Myo7b	C	A	18: 32,010,079	V189F	probably damaging	Het
Ndc1	T	C	4: 107,393,158	S533P	probably damaging	Het
Ndrg3	T	C	2: 156,944,027	D164G	probably damaging	Het
Nol11	C	T	11: 107,173,628	C500Y	possibly damaging	Het
Nsd3	A	G	8: 25,706,614	N1208D	probably benign	Het
Nup155	C	T	15: 8,156,678		probably benign	Het
Olfr768	A	G	10: 129,093,842	I44T	possibly damaging	Het
Olfr911-ps1	A	G	9: 38,523,785	T18A	probably damaging	Het
Olfr988	A	T	2: 85,353,003	C308S	probably benign	Het
Phf3	A	G	1: 30,805,603	L1425P	probably damaging	Het
Pla2r1	A	G	2: 60,448,906	Y777H	probably damaging	Het
Pld1	A	G	3: 28,031,247	E184G	probably damaging	Het
Plxna1	T	C	6: 89,337,353		probably null	Het
Ptgfrn	T	C	3: 101,043,402	E865G	probably damaging	Het
Ptpn13	G	T	5: 103,589,854		probably benign	Het
Pygb	G	T	2: 150,828,553	V763F	probably benign	Het
Ros1	A	C	10: 52,090,995	Y1705*	probably null	Het
Sec61a2	A	G	2: 5,893,216	F5L	probably benign	Het
Skint5	A	G	4: 113,756,905		probably null	Het
Sntg2	A	G	12: 30,312,567	V60A	probably damaging	Het
Sppl2a	A	G	2: 126,920,322	C280R	possibly damaging	Het
Srrm4	A	C	5: 116,446,544	M1R	probably null	Het
Sult1c1	T	C	17: 53,972,015	E91G	probably damaging	Het
Themis2	C	G	4: 132,785,595	R440P	probably damaging	Het
Tmem229a	A	G	6: 24,955,059	L232P	probably benign	Het
Trappc1	T	C	11: 69,324,422	F43L	probably damaging	Het
Trappc11	A	T	8: 47,498,673	Y982N	possibly damaging	Het
Trpv6	A	T	6: 41,627,405	M139K	probably damaging	Het
Txnrd3	A	G	6: 89,663,075		probably null	Het
Vmn1r184	T	A	7: 26,267,583	Y251*	probably null	Het
Vmn1r216	A	G	13: 23,099,374	N76D	possibly damaging	Het
Vmn1r71	C	A	7: 10,747,865	V233F	probably benign	Het
Vps13a	A	C	19: 16,766,493		probably benign	Het
Vwa5b2	A	G	16: 20,601,608	S756G	probably damaging	Het
Wdr36	T	A	18: 32,861,485		probably null	Het
Wdr86	A	G	5: 24,718,307	V129A	probably benign	Het
Zfyve9	A	G	4: 108,719,743	L47S	probably benign	Het

Other mutations in Olfr921

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00948:Olfr921	APN	9	38775812	nonsense	probably null
IGL01016:Olfr921	APN	9	38775441	missense	probably damaging	0.99
IGL01391:Olfr921	APN	9	38775530	missense	probably damaging	1.00
IGL01451:Olfr921	APN	9	38775929	missense	probably benign	0.04
IGL02250:Olfr921	APN	9	38775554	missense	probably damaging	1.00
R0026:Olfr921	UTSW	9	38775596	missense	probably benign	0.01
R0334:Olfr921	UTSW	9	38775239	critical splice acceptor site	probably null
R0655:Olfr921	UTSW	9	38775554	nonsense	probably null
R1024:Olfr921	UTSW	9	38775335	missense	probably damaging	0.97
R3967:Olfr921	UTSW	9	38775368	missense	probably benign	0.09
R3968:Olfr921	UTSW	9	38775368	missense	probably benign	0.09
R3969:Olfr921	UTSW	9	38775368	missense	probably benign	0.09
R4761:Olfr921	UTSW	9	38775837	missense	probably benign	0.05
R4796:Olfr921	UTSW	9	38775374	missense	probably benign	0.15
R4880:Olfr921	UTSW	9	38775547	nonsense	probably null
R5237:Olfr921	UTSW	9	38775956	missense	probably damaging	1.00
R5756:Olfr921	UTSW	9	38775258	start codon destroyed	probably null	1.00
R6230:Olfr921	UTSW	9	38775777	missense	possibly damaging	0.94
R6487:Olfr921	UTSW	9	38775435	missense	probably damaging	1.00
R7514:Olfr921	UTSW	9	38775678	missense	probably damaging	1.00
R7573:Olfr921	UTSW	9	38775495	missense	probably damaging	1.00
R7755:Olfr921	UTSW	9	38775777	missense	possibly damaging	0.94
R8195:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8196:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8197:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8199:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8211:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8212:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8236:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8239:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8279:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8282:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R8283:Olfr921	UTSW	9	38775281	missense	noncoding transcript
R9207:Olfr921	UTSW	9	38775664	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- GGATGTATGTCCCAACTCTACTTC -3'
(R):5'- CGGCCCAAAGTGGATCTTATTTG -3'

Sequencing Primer
(F):5'- GTATGTCCCAACTCTACTTCTTTTG -3'
(R):5'- CCAAAGTGGATCTTATTTGGAAAATG -3'

Posted On

2015-02-18