Incidental Mutation 'R3522:Olfr921'
ID267553
Institutional Source Beutler Lab
Gene Symbol Olfr921
Ensembl Gene ENSMUSG00000049926
Gene Nameolfactory receptor 921
SynonymsMOR165-8, GA_x6K02T2PVTD-32478047-32478988
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38773068-38779021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38775720 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 155 (D155V)
Ref Sequence ENSEMBL: ENSMUSP00000150844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071681] [ENSMUST00000213958] [ENSMUST00000217114]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062124
AA Change: D155V

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051879
Gene: ENSMUSG00000049926
AA Change: D155V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-48 PFAM
Pfam:7tm_1 41 290 6.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071681
AA Change: D155V

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071604
Gene: ENSMUSG00000049926
AA Change: D155V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-51 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213958
AA Change: D155V

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217114
AA Change: D155V

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr36 T A 18: 32,861,485 probably null Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Olfr921
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr921 APN 9 38775812 nonsense probably null
IGL01016:Olfr921 APN 9 38775441 missense probably damaging 0.99
IGL01391:Olfr921 APN 9 38775530 missense probably damaging 1.00
IGL01451:Olfr921 APN 9 38775929 missense probably benign 0.04
IGL02250:Olfr921 APN 9 38775554 missense probably damaging 1.00
R0026:Olfr921 UTSW 9 38775596 missense probably benign 0.01
R0334:Olfr921 UTSW 9 38775239 critical splice acceptor site probably null
R0655:Olfr921 UTSW 9 38775554 nonsense probably null
R1024:Olfr921 UTSW 9 38775335 missense probably damaging 0.97
R3967:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3968:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R3969:Olfr921 UTSW 9 38775368 missense probably benign 0.09
R4761:Olfr921 UTSW 9 38775837 missense probably benign 0.05
R4796:Olfr921 UTSW 9 38775374 missense probably benign 0.15
R4880:Olfr921 UTSW 9 38775547 nonsense probably null
R5237:Olfr921 UTSW 9 38775956 missense probably damaging 1.00
R5756:Olfr921 UTSW 9 38775258 start codon destroyed probably null 1.00
R6230:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R6487:Olfr921 UTSW 9 38775435 missense probably damaging 1.00
R7514:Olfr921 UTSW 9 38775678 missense probably damaging 1.00
R7573:Olfr921 UTSW 9 38775495 missense probably damaging 1.00
R7755:Olfr921 UTSW 9 38775777 missense possibly damaging 0.94
R8195:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8196:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8197:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8199:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8211:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8212:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8236:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8239:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8279:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8282:Olfr921 UTSW 9 38775281 missense noncoding transcript
R8283:Olfr921 UTSW 9 38775281 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGATGTATGTCCCAACTCTACTTC -3'
(R):5'- CGGCCCAAAGTGGATCTTATTTG -3'

Sequencing Primer
(F):5'- GTATGTCCCAACTCTACTTCTTTTG -3'
(R):5'- CCAAAGTGGATCTTATTTGGAAAATG -3'
Posted On2015-02-18