Mutagenetix > Incidental Mutation

Incidental Mutation 'R3522:Gpc5'

267569

Institutional Source

Beutler Lab

Gene Symbol

Gpc5

Ensembl Gene

ENSMUSG00000022112

Gene Name

glypican 5

Synonyms

A230034F01Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3522 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115092215-116525179 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116524335 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 612 (H612Q)

Ref Sequence

ENSEMBL: ENSMUSP00000135085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000176912]

AlphaFold

Q8CAL5

Predicted Effect

probably benign
Transcript: ENSMUST00000022707
AA Change: H539Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: H539Q

Domain	Start	End	E-Value	Type
Pfam:Glypican	9	572	1.8e-182	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176912
AA Change: H612Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: H612Q

Domain	Start	End	E-Value	Type
Pfam:Glypican	85	642	1.6e-174	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	G	5: 24,549,626		probably null	Het
Ankrd35	A	G	3: 96,685,062	E888G	probably damaging	Het
Arhgef10	T	C	8: 14,954,918	F150S	probably damaging	Het
Atp10d	G	T	5: 72,239,157	R235L	probably benign	Het
Cacna1b	A	G	2: 24,763,043	V2A	possibly damaging	Het
Cand1	A	T	10: 119,239,197	L15Q	probably benign	Het
Cavin3	C	A	7: 105,481,143	G154V	probably benign	Het
Ccdc73	A	T	2: 104,991,485	D593V	probably damaging	Het
Cdk5rap2	T	C	4: 70,250,410	K161E	probably damaging	Het
Chil4	A	T	3: 106,203,740	N279K	probably benign	Het
Chst13	T	G	6: 90,318,263	D56A	probably damaging	Het
Cnn1	C	A	9: 22,099,368	H5N	probably benign	Het
Cpsf4l	T	A	11: 113,702,493	K88N	probably damaging	Het
Ctnnbl1	G	T	2: 157,871,193		probably null	Het
Dnah7a	A	C	1: 53,618,116	F834V	probably damaging	Het
Fbxo41	A	G	6: 85,484,181	S182P	probably benign	Het
Fkbp5	T	C	17: 28,415,996	T180A	probably benign	Het
Flg2	T	A	3: 93,220,027	I2082N	unknown	Het
Gm4968	A	G	6: 127,233,762		noncoding transcript	Het
Gsg1	A	T	6: 135,241,253	V212D	probably damaging	Het
Hipk1	A	G	3: 103,744,114	V1111A	probably damaging	Het
Hormad1	A	T	3: 95,576,285	Q136L	probably benign	Het
Ifi35	T	A	11: 101,457,685	S147R	probably benign	Het
Iqgap3	C	T	3: 88,090,782	A282V	probably null	Het
Jmy	T	C	13: 93,454,050	D515G	probably damaging	Het
Kctd10	G	A	5: 114,374,923	R64C	probably damaging	Het
Kidins220	T	C	12: 24,990,758	V121A	probably damaging	Het
Lcn3	G	A	2: 25,766,121	V63M	possibly damaging	Het
Lmx1b	T	A	2: 33,639,531	Y72F	probably benign	Het
Lrp1	T	C	10: 127,553,555	D3164G	probably damaging	Het
Mdh1b	C	T	1: 63,719,768	V222M	probably damaging	Het
Mst1	T	C	9: 108,081,503		probably benign	Het
Myo7b	C	A	18: 32,010,079	V189F	probably damaging	Het
Ndc1	T	C	4: 107,393,158	S533P	probably damaging	Het
Ndrg3	T	C	2: 156,944,027	D164G	probably damaging	Het
Nol11	C	T	11: 107,173,628	C500Y	possibly damaging	Het
Nsd3	A	G	8: 25,706,614	N1208D	probably benign	Het
Nup155	C	T	15: 8,156,678		probably benign	Het
Olfr768	A	G	10: 129,093,842	I44T	possibly damaging	Het
Olfr911-ps1	A	G	9: 38,523,785	T18A	probably damaging	Het
Olfr921	A	T	9: 38,775,720	D155V	possibly damaging	Het
Olfr988	A	T	2: 85,353,003	C308S	probably benign	Het
Phf3	A	G	1: 30,805,603	L1425P	probably damaging	Het
Pla2r1	A	G	2: 60,448,906	Y777H	probably damaging	Het
Pld1	A	G	3: 28,031,247	E184G	probably damaging	Het
Plxna1	T	C	6: 89,337,353		probably null	Het
Ptgfrn	T	C	3: 101,043,402	E865G	probably damaging	Het
Ptpn13	G	T	5: 103,589,854		probably benign	Het
Pygb	G	T	2: 150,828,553	V763F	probably benign	Het
Ros1	A	C	10: 52,090,995	Y1705*	probably null	Het
Sec61a2	A	G	2: 5,893,216	F5L	probably benign	Het
Skint5	A	G	4: 113,756,905		probably null	Het
Sntg2	A	G	12: 30,312,567	V60A	probably damaging	Het
Sppl2a	A	G	2: 126,920,322	C280R	possibly damaging	Het
Srrm4	A	C	5: 116,446,544	M1R	probably null	Het
Sult1c1	T	C	17: 53,972,015	E91G	probably damaging	Het
Themis2	C	G	4: 132,785,595	R440P	probably damaging	Het
Tmem229a	A	G	6: 24,955,059	L232P	probably benign	Het
Trappc1	T	C	11: 69,324,422	F43L	probably damaging	Het
Trappc11	A	T	8: 47,498,673	Y982N	possibly damaging	Het
Trpv6	A	T	6: 41,627,405	M139K	probably damaging	Het
Txnrd3	A	G	6: 89,663,075		probably null	Het
Vmn1r184	T	A	7: 26,267,583	Y251*	probably null	Het
Vmn1r216	A	G	13: 23,099,374	N76D	possibly damaging	Het
Vmn1r71	C	A	7: 10,747,865	V233F	probably benign	Het
Vps13a	A	C	19: 16,766,493		probably benign	Het
Vwa5b2	A	G	16: 20,601,608	S756G	probably damaging	Het
Wdr36	T	A	18: 32,861,485		probably null	Het
Wdr86	A	G	5: 24,718,307	V129A	probably benign	Het
Zfyve9	A	G	4: 108,719,743	L47S	probably benign	Het

Other mutations in Gpc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Gpc5	APN	14	115370024	missense	probably damaging	1.00
IGL01298:Gpc5	APN	14	115399188	missense	probably benign	0.14
IGL01359:Gpc5	APN	14	115369750	missense	possibly damaging	0.74
IGL02354:Gpc5	APN	14	115133287	nonsense	probably null
IGL02361:Gpc5	APN	14	115133287	nonsense	probably null
IGL02982:Gpc5	APN	14	115369988	missense	probably damaging	1.00
IGL03120:Gpc5	APN	14	115370144	missense	possibly damaging	0.64
R0322:Gpc5	UTSW	14	115399151	missense	probably benign	0.05
R0396:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R0555:Gpc5	UTSW	14	115552328	missense	probably damaging	0.98
R0629:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R1536:Gpc5	UTSW	14	115399250	missense	probably benign	0.09
R1660:Gpc5	UTSW	14	115399279	missense	probably benign	0.12
R1676:Gpc5	UTSW	14	115370098	missense	probably damaging	1.00
R2328:Gpc5	UTSW	14	115788179	missense	probably damaging	0.99
R3776:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3885:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3889:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3893:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R4041:Gpc5	UTSW	14	115133216	missense	probably damaging	1.00
R4517:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R5068:Gpc5	UTSW	14	115417264	makesense	probably null
R5639:Gpc5	UTSW	14	115092747	missense	probably benign	0.13
R5730:Gpc5	UTSW	14	115788314	missense	possibly damaging	0.73
R5944:Gpc5	UTSW	14	115369838	missense	probably benign	0.24
R6351:Gpc5	UTSW	14	115399200	missense	probably benign	0.01
R6557:Gpc5	UTSW	14	115092534	unclassified	probably benign
R6657:Gpc5	UTSW	14	115370198	missense	probably benign	0.01
R6714:Gpc5	UTSW	14	115552303	nonsense	probably null
R6751:Gpc5	UTSW	14	115369951	missense	probably benign	0.00
R7057:Gpc5	UTSW	14	115133242	missense	possibly damaging	0.64
R7142:Gpc5	UTSW	14	115417203	missense	probably benign	0.01
R7225:Gpc5	UTSW	14	115552298	missense	probably damaging	1.00
R7544:Gpc5	UTSW	14	115428173	missense	probably damaging	1.00
R7658:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R7695:Gpc5	UTSW	14	115092594	missense	unknown
R7785:Gpc5	UTSW	14	115417220	missense	probably benign	0.00
R8116:Gpc5	UTSW	14	115399225	missense	probably damaging	0.98
R8303:Gpc5	UTSW	14	115428255	missense	probably benign	0.01
R8983:Gpc5	UTSW	14	115092686	missense	unknown
RF001:Gpc5	UTSW	14	115417178	missense	probably benign	0.41
RF022:Gpc5	UTSW	14	115552276	missense	probably damaging	1.00
Z1176:Gpc5	UTSW	14	115369964	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTGGAGTCTGGGTGAAAAC -3'
(R):5'- AACATTCCAGTTGGCATCTAAGAAG -3'

Sequencing Primer
(F):5'- TCTGGGTGAAAACAGAGAAGCC -3'
(R):5'- GTTAGAATAACACACCTTTCCCTC -3'

Posted On

2015-02-18