Incidental Mutation 'R3522:Vwa5b2'
ID 267572
Institutional Source Beutler Lab
Gene Symbol Vwa5b2
Ensembl Gene ENSMUSG00000046613
Gene Name von Willebrand factor A domain containing 5B2
Synonyms EG328644
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20408221-20424127 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20420358 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 756 (S756G)
Ref Sequence ENSEMBL: ENSMUSP00000123727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045918] [ENSMUST00000096197] [ENSMUST00000100074] [ENSMUST00000123774] [ENSMUST00000159780] [ENSMUST00000231386] [ENSMUST00000231749] [ENSMUST00000231531] [ENSMUST00000231904] [ENSMUST00000147867] [ENSMUST00000149236] [ENSMUST00000231387] [ENSMUST00000231471] [ENSMUST00000231362] [ENSMUST00000232451] [ENSMUST00000232319] [ENSMUST00000232458]
AlphaFold Q3UR50
Predicted Effect probably benign
Transcript: ENSMUST00000045918
SMART Domains Protein: ENSMUSP00000045272
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
Pfam:ALG3 47 406 2.5e-145 PFAM
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046188
Predicted Effect probably damaging
Transcript: ENSMUST00000096197
AA Change: S756G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093911
Gene: ENSMUSG00000046613
AA Change: S756G

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.3e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100074
SMART Domains Protein: ENSMUSP00000097652
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 1.9e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 572 586 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117019
Predicted Effect probably benign
Transcript: ENSMUST00000123774
SMART Domains Protein: ENSMUSP00000123378
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159780
AA Change: S756G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123727
Gene: ENSMUSG00000046613
AA Change: S756G

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 5.5e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127454
SMART Domains Protein: ENSMUSP00000120559
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ALG3 51 118 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231386
Predicted Effect probably benign
Transcript: ENSMUST00000231749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231608
Predicted Effect probably benign
Transcript: ENSMUST00000231531
Predicted Effect probably benign
Transcript: ENSMUST00000231904
Predicted Effect probably benign
Transcript: ENSMUST00000147867
Predicted Effect probably benign
Transcript: ENSMUST00000149236
SMART Domains Protein: ENSMUSP00000124117
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.9e-32 PFAM
Blast:VWA 352 408 2e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231387
Predicted Effect probably benign
Transcript: ENSMUST00000231471
Predicted Effect probably benign
Transcript: ENSMUST00000231362
Predicted Effect probably benign
Transcript: ENSMUST00000232451
Predicted Effect probably benign
Transcript: ENSMUST00000232319
Predicted Effect probably benign
Transcript: ENSMUST00000232458
Meta Mutation Damage Score 0.1631 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,592,378 (GRCm39) E888G probably damaging Het
Arhgef10 T C 8: 15,004,918 (GRCm39) F150S probably damaging Het
Atp10d G T 5: 72,396,500 (GRCm39) R235L probably benign Het
Cacna1b A G 2: 24,653,055 (GRCm39) V2A possibly damaging Het
Cand1 A T 10: 119,075,102 (GRCm39) L15Q probably benign Het
Cavin3 C A 7: 105,130,350 (GRCm39) G154V probably benign Het
Ccdc73 A T 2: 104,821,830 (GRCm39) D593V probably damaging Het
Cdk5rap2 T C 4: 70,168,647 (GRCm39) K161E probably damaging Het
Chil4 A T 3: 106,111,056 (GRCm39) N279K probably benign Het
Chst13 T G 6: 90,295,245 (GRCm39) D56A probably damaging Het
Cnn1 C A 9: 22,010,664 (GRCm39) H5N probably benign Het
Cpsf4l T A 11: 113,593,319 (GRCm39) K88N probably damaging Het
Ctnnbl1 G T 2: 157,713,113 (GRCm39) probably null Het
Dnah7a A C 1: 53,657,275 (GRCm39) F834V probably damaging Het
Fbxo41 A G 6: 85,461,163 (GRCm39) S182P probably benign Het
Fkbp5 T C 17: 28,634,970 (GRCm39) T180A probably benign Het
Flg2 T A 3: 93,127,334 (GRCm39) I2082N unknown Het
Gm4968 A G 6: 127,210,725 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 116,761,747 (GRCm39) H612Q probably benign Het
Gsg1 A T 6: 135,218,251 (GRCm39) V212D probably damaging Het
Hipk1 A G 3: 103,651,430 (GRCm39) V1111A probably damaging Het
Hormad1 A T 3: 95,483,596 (GRCm39) Q136L probably benign Het
Ifi35 T A 11: 101,348,511 (GRCm39) S147R probably benign Het
Iqca1l A G 5: 24,754,624 (GRCm39) probably null Het
Iqgap3 C T 3: 87,998,089 (GRCm39) A282V probably null Het
Jmy T C 13: 93,590,558 (GRCm39) D515G probably damaging Het
Kctd10 G A 5: 114,512,984 (GRCm39) R64C probably damaging Het
Kidins220 T C 12: 25,040,757 (GRCm39) V121A probably damaging Het
Lcn3 G A 2: 25,656,133 (GRCm39) V63M possibly damaging Het
Lmx1b T A 2: 33,529,543 (GRCm39) Y72F probably benign Het
Lrp1 T C 10: 127,389,424 (GRCm39) D3164G probably damaging Het
Mdh1b C T 1: 63,758,927 (GRCm39) V222M probably damaging Het
Mst1 T C 9: 107,958,702 (GRCm39) probably benign Het
Myo7b C A 18: 32,143,132 (GRCm39) V189F probably damaging Het
Ndc1 T C 4: 107,250,355 (GRCm39) S533P probably damaging Het
Ndrg3 T C 2: 156,785,947 (GRCm39) D164G probably damaging Het
Nol11 C T 11: 107,064,454 (GRCm39) C500Y possibly damaging Het
Nsd3 A G 8: 26,196,642 (GRCm39) N1208D probably benign Het
Nup155 C T 15: 8,186,162 (GRCm39) probably benign Het
Or5ak20 A T 2: 85,183,347 (GRCm39) C308S probably benign Het
Or6c38 A G 10: 128,929,711 (GRCm39) I44T possibly damaging Het
Or8b47 A G 9: 38,435,081 (GRCm39) T18A probably damaging Het
Or8b54 A T 9: 38,687,016 (GRCm39) D155V possibly damaging Het
Phf3 A G 1: 30,844,684 (GRCm39) L1425P probably damaging Het
Pla2r1 A G 2: 60,279,250 (GRCm39) Y777H probably damaging Het
Pld1 A G 3: 28,085,396 (GRCm39) E184G probably damaging Het
Plxna1 T C 6: 89,314,335 (GRCm39) probably null Het
Ptgfrn T C 3: 100,950,718 (GRCm39) E865G probably damaging Het
Ptpn13 G T 5: 103,737,720 (GRCm39) probably benign Het
Pygb G T 2: 150,670,473 (GRCm39) V763F probably benign Het
Ros1 A C 10: 51,967,091 (GRCm39) Y1705* probably null Het
Sec61a2 A G 2: 5,898,027 (GRCm39) F5L probably benign Het
Skint5 A G 4: 113,614,102 (GRCm39) probably null Het
Sntg2 A G 12: 30,362,566 (GRCm39) V60A probably damaging Het
Sppl2a A G 2: 126,762,242 (GRCm39) C280R possibly damaging Het
Srrm4 A C 5: 116,584,603 (GRCm39) M1R probably null Het
Sult1c2 T C 17: 54,279,043 (GRCm39) E91G probably damaging Het
Themis2 C G 4: 132,512,906 (GRCm39) R440P probably damaging Het
Tmem229a A G 6: 24,955,058 (GRCm39) L232P probably benign Het
Trappc1 T C 11: 69,215,248 (GRCm39) F43L probably damaging Het
Trappc11 A T 8: 47,951,708 (GRCm39) Y982N possibly damaging Het
Trpv6 A T 6: 41,604,339 (GRCm39) M139K probably damaging Het
Txnrd3 A G 6: 89,640,057 (GRCm39) probably null Het
Vmn1r184 T A 7: 25,967,008 (GRCm39) Y251* probably null Het
Vmn1r216 A G 13: 23,283,544 (GRCm39) N76D possibly damaging Het
Vmn1r71 C A 7: 10,481,792 (GRCm39) V233F probably benign Het
Vps13a A C 19: 16,743,857 (GRCm39) probably benign Het
Wdr36 T A 18: 32,994,538 (GRCm39) probably null Het
Wdr86 A G 5: 24,923,305 (GRCm39) V129A probably benign Het
Zfyve9 A G 4: 108,576,940 (GRCm39) L47S probably benign Het
Other mutations in Vwa5b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Vwa5b2 APN 16 20,423,020 (GRCm39) missense probably benign
IGL01543:Vwa5b2 APN 16 20,414,466 (GRCm39) missense probably benign 0.02
IGL01719:Vwa5b2 APN 16 20,416,183 (GRCm39) critical splice donor site probably null
IGL02006:Vwa5b2 APN 16 20,415,843 (GRCm39) missense probably damaging 0.97
IGL02150:Vwa5b2 APN 16 20,423,576 (GRCm39) missense probably benign
IGL02301:Vwa5b2 APN 16 20,423,540 (GRCm39) missense probably damaging 1.00
IGL02373:Vwa5b2 APN 16 20,423,594 (GRCm39) missense probably damaging 0.99
IGL02413:Vwa5b2 APN 16 20,416,851 (GRCm39) missense probably damaging 1.00
IGL02664:Vwa5b2 APN 16 20,414,063 (GRCm39) unclassified probably benign
R1171:Vwa5b2 UTSW 16 20,423,734 (GRCm39) missense probably benign
R1405:Vwa5b2 UTSW 16 20,423,066 (GRCm39) missense probably benign 0.00
R1405:Vwa5b2 UTSW 16 20,423,066 (GRCm39) missense probably benign 0.00
R1464:Vwa5b2 UTSW 16 20,415,019 (GRCm39) missense probably benign 0.08
R1464:Vwa5b2 UTSW 16 20,415,019 (GRCm39) missense probably benign 0.08
R1730:Vwa5b2 UTSW 16 20,419,675 (GRCm39) missense probably damaging 1.00
R1901:Vwa5b2 UTSW 16 20,423,582 (GRCm39) missense possibly damaging 0.77
R1902:Vwa5b2 UTSW 16 20,423,582 (GRCm39) missense possibly damaging 0.77
R1903:Vwa5b2 UTSW 16 20,423,582 (GRCm39) missense possibly damaging 0.77
R1959:Vwa5b2 UTSW 16 20,420,941 (GRCm39) critical splice donor site probably null
R1961:Vwa5b2 UTSW 16 20,420,941 (GRCm39) critical splice donor site probably null
R3687:Vwa5b2 UTSW 16 20,410,308 (GRCm39) unclassified probably benign
R3746:Vwa5b2 UTSW 16 20,417,076 (GRCm39) intron probably benign
R3747:Vwa5b2 UTSW 16 20,417,076 (GRCm39) intron probably benign
R3749:Vwa5b2 UTSW 16 20,417,076 (GRCm39) intron probably benign
R3952:Vwa5b2 UTSW 16 20,417,111 (GRCm39) makesense probably null
R4641:Vwa5b2 UTSW 16 20,423,393 (GRCm39) missense probably damaging 1.00
R4646:Vwa5b2 UTSW 16 20,415,079 (GRCm39) missense probably damaging 1.00
R4772:Vwa5b2 UTSW 16 20,419,553 (GRCm39) splice site probably null
R5032:Vwa5b2 UTSW 16 20,419,459 (GRCm39) missense probably damaging 1.00
R5286:Vwa5b2 UTSW 16 20,415,058 (GRCm39) missense probably damaging 1.00
R5569:Vwa5b2 UTSW 16 20,414,089 (GRCm39) missense probably damaging 1.00
R5585:Vwa5b2 UTSW 16 20,413,428 (GRCm39) nonsense probably null
R5640:Vwa5b2 UTSW 16 20,416,292 (GRCm39) missense probably damaging 1.00
R6330:Vwa5b2 UTSW 16 20,420,727 (GRCm39) missense probably damaging 1.00
R6459:Vwa5b2 UTSW 16 20,413,429 (GRCm39) missense probably damaging 0.98
R6992:Vwa5b2 UTSW 16 20,416,952 (GRCm39) missense probably damaging 1.00
R7102:Vwa5b2 UTSW 16 20,422,984 (GRCm39) missense probably benign 0.00
R7231:Vwa5b2 UTSW 16 20,422,878 (GRCm39) missense probably benign 0.00
R7591:Vwa5b2 UTSW 16 20,420,317 (GRCm39) missense probably damaging 0.96
R7765:Vwa5b2 UTSW 16 20,413,361 (GRCm39) missense probably benign
R8269:Vwa5b2 UTSW 16 20,423,188 (GRCm39) missense probably damaging 1.00
R8311:Vwa5b2 UTSW 16 20,409,972 (GRCm39) missense probably damaging 1.00
R8707:Vwa5b2 UTSW 16 20,412,965 (GRCm39) missense probably benign 0.01
R8716:Vwa5b2 UTSW 16 20,415,026 (GRCm39) missense probably benign 0.00
R8815:Vwa5b2 UTSW 16 20,419,516 (GRCm39) missense probably damaging 1.00
R8965:Vwa5b2 UTSW 16 20,415,076 (GRCm39) missense possibly damaging 0.72
R9245:Vwa5b2 UTSW 16 20,416,890 (GRCm39) missense probably damaging 1.00
R9431:Vwa5b2 UTSW 16 20,423,046 (GRCm39) missense probably benign 0.00
R9536:Vwa5b2 UTSW 16 20,414,449 (GRCm39) missense probably damaging 1.00
R9695:Vwa5b2 UTSW 16 20,422,975 (GRCm39) missense probably benign
R9727:Vwa5b2 UTSW 16 20,423,477 (GRCm39) missense probably damaging 1.00
Z1176:Vwa5b2 UTSW 16 20,410,003 (GRCm39) missense probably damaging 0.99
Z1177:Vwa5b2 UTSW 16 20,419,401 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAATGACTGTCAGACGGAG -3'
(R):5'- TTTGGTGTCAGAAAACCAGCG -3'

Sequencing Primer
(F):5'- CAGAATGACTGTCAGACGGAGTTAGG -3'
(R):5'- GTCCCATCCAACCCTTACCTGAATC -3'
Posted On 2015-02-18