Incidental Mutation 'R3522:Myo7b'
ID 267575
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32143132 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 189 (V189F)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000134663
AA Change: V189F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: V189F

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.5481 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,592,378 (GRCm39) E888G probably damaging Het
Arhgef10 T C 8: 15,004,918 (GRCm39) F150S probably damaging Het
Atp10d G T 5: 72,396,500 (GRCm39) R235L probably benign Het
Cacna1b A G 2: 24,653,055 (GRCm39) V2A possibly damaging Het
Cand1 A T 10: 119,075,102 (GRCm39) L15Q probably benign Het
Cavin3 C A 7: 105,130,350 (GRCm39) G154V probably benign Het
Ccdc73 A T 2: 104,821,830 (GRCm39) D593V probably damaging Het
Cdk5rap2 T C 4: 70,168,647 (GRCm39) K161E probably damaging Het
Chil4 A T 3: 106,111,056 (GRCm39) N279K probably benign Het
Chst13 T G 6: 90,295,245 (GRCm39) D56A probably damaging Het
Cnn1 C A 9: 22,010,664 (GRCm39) H5N probably benign Het
Cpsf4l T A 11: 113,593,319 (GRCm39) K88N probably damaging Het
Ctnnbl1 G T 2: 157,713,113 (GRCm39) probably null Het
Dnah7a A C 1: 53,657,275 (GRCm39) F834V probably damaging Het
Fbxo41 A G 6: 85,461,163 (GRCm39) S182P probably benign Het
Fkbp5 T C 17: 28,634,970 (GRCm39) T180A probably benign Het
Flg2 T A 3: 93,127,334 (GRCm39) I2082N unknown Het
Gm4968 A G 6: 127,210,725 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 116,761,747 (GRCm39) H612Q probably benign Het
Gsg1 A T 6: 135,218,251 (GRCm39) V212D probably damaging Het
Hipk1 A G 3: 103,651,430 (GRCm39) V1111A probably damaging Het
Hormad1 A T 3: 95,483,596 (GRCm39) Q136L probably benign Het
Ifi35 T A 11: 101,348,511 (GRCm39) S147R probably benign Het
Iqca1l A G 5: 24,754,624 (GRCm39) probably null Het
Iqgap3 C T 3: 87,998,089 (GRCm39) A282V probably null Het
Jmy T C 13: 93,590,558 (GRCm39) D515G probably damaging Het
Kctd10 G A 5: 114,512,984 (GRCm39) R64C probably damaging Het
Kidins220 T C 12: 25,040,757 (GRCm39) V121A probably damaging Het
Lcn3 G A 2: 25,656,133 (GRCm39) V63M possibly damaging Het
Lmx1b T A 2: 33,529,543 (GRCm39) Y72F probably benign Het
Lrp1 T C 10: 127,389,424 (GRCm39) D3164G probably damaging Het
Mdh1b C T 1: 63,758,927 (GRCm39) V222M probably damaging Het
Mst1 T C 9: 107,958,702 (GRCm39) probably benign Het
Ndc1 T C 4: 107,250,355 (GRCm39) S533P probably damaging Het
Ndrg3 T C 2: 156,785,947 (GRCm39) D164G probably damaging Het
Nol11 C T 11: 107,064,454 (GRCm39) C500Y possibly damaging Het
Nsd3 A G 8: 26,196,642 (GRCm39) N1208D probably benign Het
Nup155 C T 15: 8,186,162 (GRCm39) probably benign Het
Or5ak20 A T 2: 85,183,347 (GRCm39) C308S probably benign Het
Or6c38 A G 10: 128,929,711 (GRCm39) I44T possibly damaging Het
Or8b47 A G 9: 38,435,081 (GRCm39) T18A probably damaging Het
Or8b54 A T 9: 38,687,016 (GRCm39) D155V possibly damaging Het
Phf3 A G 1: 30,844,684 (GRCm39) L1425P probably damaging Het
Pla2r1 A G 2: 60,279,250 (GRCm39) Y777H probably damaging Het
Pld1 A G 3: 28,085,396 (GRCm39) E184G probably damaging Het
Plxna1 T C 6: 89,314,335 (GRCm39) probably null Het
Ptgfrn T C 3: 100,950,718 (GRCm39) E865G probably damaging Het
Ptpn13 G T 5: 103,737,720 (GRCm39) probably benign Het
Pygb G T 2: 150,670,473 (GRCm39) V763F probably benign Het
Ros1 A C 10: 51,967,091 (GRCm39) Y1705* probably null Het
Sec61a2 A G 2: 5,898,027 (GRCm39) F5L probably benign Het
Skint5 A G 4: 113,614,102 (GRCm39) probably null Het
Sntg2 A G 12: 30,362,566 (GRCm39) V60A probably damaging Het
Sppl2a A G 2: 126,762,242 (GRCm39) C280R possibly damaging Het
Srrm4 A C 5: 116,584,603 (GRCm39) M1R probably null Het
Sult1c2 T C 17: 54,279,043 (GRCm39) E91G probably damaging Het
Themis2 C G 4: 132,512,906 (GRCm39) R440P probably damaging Het
Tmem229a A G 6: 24,955,058 (GRCm39) L232P probably benign Het
Trappc1 T C 11: 69,215,248 (GRCm39) F43L probably damaging Het
Trappc11 A T 8: 47,951,708 (GRCm39) Y982N possibly damaging Het
Trpv6 A T 6: 41,604,339 (GRCm39) M139K probably damaging Het
Txnrd3 A G 6: 89,640,057 (GRCm39) probably null Het
Vmn1r184 T A 7: 25,967,008 (GRCm39) Y251* probably null Het
Vmn1r216 A G 13: 23,283,544 (GRCm39) N76D possibly damaging Het
Vmn1r71 C A 7: 10,481,792 (GRCm39) V233F probably benign Het
Vps13a A C 19: 16,743,857 (GRCm39) probably benign Het
Vwa5b2 A G 16: 20,420,358 (GRCm39) S756G probably damaging Het
Wdr36 T A 18: 32,994,538 (GRCm39) probably null Het
Wdr86 A G 5: 24,923,305 (GRCm39) V129A probably benign Het
Zfyve9 A G 4: 108,576,940 (GRCm39) L47S probably benign Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTATCTTTAAAGGAATACTGTAGGG -3'
(R):5'- CACGGAGGTCATTTATAGAGAGTGG -3'

Sequencing Primer
(F):5'- TCTCCTGTGCTAGAATTACAACAGC -3'
(R):5'- TCATTTATAGAGAGTGGAGAAGCTC -3'
Posted On 2015-02-18