Incidental Mutation 'R3522:Wdr36'
ID267576
Institutional Source Beutler Lab
Gene Symbol Wdr36
Ensembl Gene ENSMUSG00000038299
Gene NameWD repeat domain 36
Synonyms5730444A13Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3522 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32837225-32866420 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 32861485 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053663] [ENSMUST00000166214]
Predicted Effect probably null
Transcript: ENSMUST00000053663
SMART Domains Protein: ENSMUSP00000052465
Gene: ENSMUSG00000038299

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 673 895 9.7e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166214
SMART Domains Protein: ENSMUSP00000132189
Gene: ENSMUSG00000038299

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 668 883 6.1e-72 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Mutations in this gene have been associated with adult-onset primary open-angle glaucoma (POAG). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality before implantation. In culture, homozygous mutant embryos fail to reach the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,549,626 probably null Het
Ankrd35 A G 3: 96,685,062 E888G probably damaging Het
Arhgef10 T C 8: 14,954,918 F150S probably damaging Het
Atp10d G T 5: 72,239,157 R235L probably benign Het
Cacna1b A G 2: 24,763,043 V2A possibly damaging Het
Cand1 A T 10: 119,239,197 L15Q probably benign Het
Cavin3 C A 7: 105,481,143 G154V probably benign Het
Ccdc73 A T 2: 104,991,485 D593V probably damaging Het
Cdk5rap2 T C 4: 70,250,410 K161E probably damaging Het
Chil4 A T 3: 106,203,740 N279K probably benign Het
Chst13 T G 6: 90,318,263 D56A probably damaging Het
Cnn1 C A 9: 22,099,368 H5N probably benign Het
Cpsf4l T A 11: 113,702,493 K88N probably damaging Het
Ctnnbl1 G T 2: 157,871,193 probably null Het
Dnah7a A C 1: 53,618,116 F834V probably damaging Het
Fbxo41 A G 6: 85,484,181 S182P probably benign Het
Fkbp5 T C 17: 28,415,996 T180A probably benign Het
Flg2 T A 3: 93,220,027 I2082N unknown Het
Gm4968 A G 6: 127,233,762 noncoding transcript Het
Gpc5 T A 14: 116,524,335 H612Q probably benign Het
Gsg1 A T 6: 135,241,253 V212D probably damaging Het
Hipk1 A G 3: 103,744,114 V1111A probably damaging Het
Hormad1 A T 3: 95,576,285 Q136L probably benign Het
Ifi35 T A 11: 101,457,685 S147R probably benign Het
Iqgap3 C T 3: 88,090,782 A282V probably null Het
Jmy T C 13: 93,454,050 D515G probably damaging Het
Kctd10 G A 5: 114,374,923 R64C probably damaging Het
Kidins220 T C 12: 24,990,758 V121A probably damaging Het
Lcn3 G A 2: 25,766,121 V63M possibly damaging Het
Lmx1b T A 2: 33,639,531 Y72F probably benign Het
Lrp1 T C 10: 127,553,555 D3164G probably damaging Het
Mdh1b C T 1: 63,719,768 V222M probably damaging Het
Mst1 T C 9: 108,081,503 probably benign Het
Myo7b C A 18: 32,010,079 V189F probably damaging Het
Ndc1 T C 4: 107,393,158 S533P probably damaging Het
Ndrg3 T C 2: 156,944,027 D164G probably damaging Het
Nol11 C T 11: 107,173,628 C500Y possibly damaging Het
Nsd3 A G 8: 25,706,614 N1208D probably benign Het
Nup155 C T 15: 8,156,678 probably benign Het
Olfr768 A G 10: 129,093,842 I44T possibly damaging Het
Olfr911-ps1 A G 9: 38,523,785 T18A probably damaging Het
Olfr921 A T 9: 38,775,720 D155V possibly damaging Het
Olfr988 A T 2: 85,353,003 C308S probably benign Het
Phf3 A G 1: 30,805,603 L1425P probably damaging Het
Pla2r1 A G 2: 60,448,906 Y777H probably damaging Het
Pld1 A G 3: 28,031,247 E184G probably damaging Het
Plxna1 T C 6: 89,337,353 probably null Het
Ptgfrn T C 3: 101,043,402 E865G probably damaging Het
Ptpn13 G T 5: 103,589,854 probably benign Het
Pygb G T 2: 150,828,553 V763F probably benign Het
Ros1 A C 10: 52,090,995 Y1705* probably null Het
Sec61a2 A G 2: 5,893,216 F5L probably benign Het
Skint5 A G 4: 113,756,905 probably null Het
Sntg2 A G 12: 30,312,567 V60A probably damaging Het
Sppl2a A G 2: 126,920,322 C280R possibly damaging Het
Srrm4 A C 5: 116,446,544 M1R probably null Het
Sult1c1 T C 17: 53,972,015 E91G probably damaging Het
Themis2 C G 4: 132,785,595 R440P probably damaging Het
Tmem229a A G 6: 24,955,059 L232P probably benign Het
Trappc1 T C 11: 69,324,422 F43L probably damaging Het
Trappc11 A T 8: 47,498,673 Y982N possibly damaging Het
Trpv6 A T 6: 41,627,405 M139K probably damaging Het
Txnrd3 A G 6: 89,663,075 probably null Het
Vmn1r184 T A 7: 26,267,583 Y251* probably null Het
Vmn1r216 A G 13: 23,099,374 N76D possibly damaging Het
Vmn1r71 C A 7: 10,747,865 V233F probably benign Het
Vps13a A C 19: 16,766,493 probably benign Het
Vwa5b2 A G 16: 20,601,608 S756G probably damaging Het
Wdr86 A G 5: 24,718,307 V129A probably benign Het
Zfyve9 A G 4: 108,719,743 L47S probably benign Het
Other mutations in Wdr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Wdr36 APN 18 32845631 missense possibly damaging 0.86
IGL01975:Wdr36 APN 18 32852488 missense probably damaging 1.00
IGL02001:Wdr36 APN 18 32852888 missense probably damaging 1.00
IGL02605:Wdr36 APN 18 32851991 missense possibly damaging 0.94
IGL02625:Wdr36 APN 18 32859261 missense possibly damaging 0.51
IGL02928:Wdr36 APN 18 32847319 critical splice donor site probably null
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0331:Wdr36 UTSW 18 32852915 missense possibly damaging 0.83
R0626:Wdr36 UTSW 18 32850531 missense probably damaging 1.00
R0835:Wdr36 UTSW 18 32849082 missense possibly damaging 0.87
R1484:Wdr36 UTSW 18 32843885 missense possibly damaging 0.77
R1498:Wdr36 UTSW 18 32852968 missense possibly damaging 0.95
R4521:Wdr36 UTSW 18 32841148 splice site probably null
R4902:Wdr36 UTSW 18 32859261 missense possibly damaging 0.51
R5482:Wdr36 UTSW 18 32841904 missense probably benign 0.19
R5574:Wdr36 UTSW 18 32865959 missense probably damaging 1.00
R5627:Wdr36 UTSW 18 32861638 missense possibly damaging 0.73
R6076:Wdr36 UTSW 18 32846945 missense probably damaging 1.00
R6186:Wdr36 UTSW 18 32852901 missense probably benign 0.19
R6228:Wdr36 UTSW 18 32842006 missense possibly damaging 0.67
R7027:Wdr36 UTSW 18 32841905 missense probably benign 0.04
R7112:Wdr36 UTSW 18 32839451 missense probably benign 0.34
R7635:Wdr36 UTSW 18 32850525 missense probably benign 0.19
R7642:Wdr36 UTSW 18 32854571 splice site probably null
R7998:Wdr36 UTSW 18 32852519 missense probably damaging 1.00
R8200:Wdr36 UTSW 18 32865926 missense probably benign 0.10
R8203:Wdr36 UTSW 18 32852083 nonsense probably null
R8257:Wdr36 UTSW 18 32841286 intron probably benign
R8334:Wdr36 UTSW 18 32859293 missense possibly damaging 0.95
R8845:Wdr36 UTSW 18 32861045 nonsense probably null
R8894:Wdr36 UTSW 18 32837287 start gained probably benign
R8901:Wdr36 UTSW 18 32846960 missense probably damaging 1.00
X0063:Wdr36 UTSW 18 32864722 missense probably damaging 0.96
Z1088:Wdr36 UTSW 18 32866012 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGTACTTGTCAAACCCAAGG -3'
(R):5'- ACACTAGAGCAGTACCTTGATAAC -3'

Sequencing Primer
(F):5'- GGTACTTGTCAAACCCAAGGTAATC -3'
(R):5'- CATCAAGATTCAGAAGGTTTTTCCAG -3'
Posted On2015-02-18