Incidental Mutation 'R3522:Wdr36'
ID 267576
Institutional Source Beutler Lab
Gene Symbol Wdr36
Ensembl Gene ENSMUSG00000038299
Gene Name WD repeat domain 36
Synonyms 5730444A13Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3522 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 32970241-33000008 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 32994538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053663] [ENSMUST00000166214]
AlphaFold Q3TAQ9
Predicted Effect probably null
Transcript: ENSMUST00000053663
SMART Domains Protein: ENSMUSP00000052465
Gene: ENSMUSG00000038299

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 673 895 9.7e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166214
SMART Domains Protein: ENSMUSP00000132189
Gene: ENSMUSG00000038299

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 668 883 6.1e-72 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Mutations in this gene have been associated with adult-onset primary open-angle glaucoma (POAG). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality before implantation. In culture, homozygous mutant embryos fail to reach the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A G 3: 96,592,378 (GRCm39) E888G probably damaging Het
Arhgef10 T C 8: 15,004,918 (GRCm39) F150S probably damaging Het
Atp10d G T 5: 72,396,500 (GRCm39) R235L probably benign Het
Cacna1b A G 2: 24,653,055 (GRCm39) V2A possibly damaging Het
Cand1 A T 10: 119,075,102 (GRCm39) L15Q probably benign Het
Cavin3 C A 7: 105,130,350 (GRCm39) G154V probably benign Het
Ccdc73 A T 2: 104,821,830 (GRCm39) D593V probably damaging Het
Cdk5rap2 T C 4: 70,168,647 (GRCm39) K161E probably damaging Het
Chil4 A T 3: 106,111,056 (GRCm39) N279K probably benign Het
Chst13 T G 6: 90,295,245 (GRCm39) D56A probably damaging Het
Cnn1 C A 9: 22,010,664 (GRCm39) H5N probably benign Het
Cpsf4l T A 11: 113,593,319 (GRCm39) K88N probably damaging Het
Ctnnbl1 G T 2: 157,713,113 (GRCm39) probably null Het
Dnah7a A C 1: 53,657,275 (GRCm39) F834V probably damaging Het
Fbxo41 A G 6: 85,461,163 (GRCm39) S182P probably benign Het
Fkbp5 T C 17: 28,634,970 (GRCm39) T180A probably benign Het
Flg2 T A 3: 93,127,334 (GRCm39) I2082N unknown Het
Gm4968 A G 6: 127,210,725 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 116,761,747 (GRCm39) H612Q probably benign Het
Gsg1 A T 6: 135,218,251 (GRCm39) V212D probably damaging Het
Hipk1 A G 3: 103,651,430 (GRCm39) V1111A probably damaging Het
Hormad1 A T 3: 95,483,596 (GRCm39) Q136L probably benign Het
Ifi35 T A 11: 101,348,511 (GRCm39) S147R probably benign Het
Iqca1l A G 5: 24,754,624 (GRCm39) probably null Het
Iqgap3 C T 3: 87,998,089 (GRCm39) A282V probably null Het
Jmy T C 13: 93,590,558 (GRCm39) D515G probably damaging Het
Kctd10 G A 5: 114,512,984 (GRCm39) R64C probably damaging Het
Kidins220 T C 12: 25,040,757 (GRCm39) V121A probably damaging Het
Lcn3 G A 2: 25,656,133 (GRCm39) V63M possibly damaging Het
Lmx1b T A 2: 33,529,543 (GRCm39) Y72F probably benign Het
Lrp1 T C 10: 127,389,424 (GRCm39) D3164G probably damaging Het
Mdh1b C T 1: 63,758,927 (GRCm39) V222M probably damaging Het
Mst1 T C 9: 107,958,702 (GRCm39) probably benign Het
Myo7b C A 18: 32,143,132 (GRCm39) V189F probably damaging Het
Ndc1 T C 4: 107,250,355 (GRCm39) S533P probably damaging Het
Ndrg3 T C 2: 156,785,947 (GRCm39) D164G probably damaging Het
Nol11 C T 11: 107,064,454 (GRCm39) C500Y possibly damaging Het
Nsd3 A G 8: 26,196,642 (GRCm39) N1208D probably benign Het
Nup155 C T 15: 8,186,162 (GRCm39) probably benign Het
Or5ak20 A T 2: 85,183,347 (GRCm39) C308S probably benign Het
Or6c38 A G 10: 128,929,711 (GRCm39) I44T possibly damaging Het
Or8b47 A G 9: 38,435,081 (GRCm39) T18A probably damaging Het
Or8b54 A T 9: 38,687,016 (GRCm39) D155V possibly damaging Het
Phf3 A G 1: 30,844,684 (GRCm39) L1425P probably damaging Het
Pla2r1 A G 2: 60,279,250 (GRCm39) Y777H probably damaging Het
Pld1 A G 3: 28,085,396 (GRCm39) E184G probably damaging Het
Plxna1 T C 6: 89,314,335 (GRCm39) probably null Het
Ptgfrn T C 3: 100,950,718 (GRCm39) E865G probably damaging Het
Ptpn13 G T 5: 103,737,720 (GRCm39) probably benign Het
Pygb G T 2: 150,670,473 (GRCm39) V763F probably benign Het
Ros1 A C 10: 51,967,091 (GRCm39) Y1705* probably null Het
Sec61a2 A G 2: 5,898,027 (GRCm39) F5L probably benign Het
Skint5 A G 4: 113,614,102 (GRCm39) probably null Het
Sntg2 A G 12: 30,362,566 (GRCm39) V60A probably damaging Het
Sppl2a A G 2: 126,762,242 (GRCm39) C280R possibly damaging Het
Srrm4 A C 5: 116,584,603 (GRCm39) M1R probably null Het
Sult1c2 T C 17: 54,279,043 (GRCm39) E91G probably damaging Het
Themis2 C G 4: 132,512,906 (GRCm39) R440P probably damaging Het
Tmem229a A G 6: 24,955,058 (GRCm39) L232P probably benign Het
Trappc1 T C 11: 69,215,248 (GRCm39) F43L probably damaging Het
Trappc11 A T 8: 47,951,708 (GRCm39) Y982N possibly damaging Het
Trpv6 A T 6: 41,604,339 (GRCm39) M139K probably damaging Het
Txnrd3 A G 6: 89,640,057 (GRCm39) probably null Het
Vmn1r184 T A 7: 25,967,008 (GRCm39) Y251* probably null Het
Vmn1r216 A G 13: 23,283,544 (GRCm39) N76D possibly damaging Het
Vmn1r71 C A 7: 10,481,792 (GRCm39) V233F probably benign Het
Vps13a A C 19: 16,743,857 (GRCm39) probably benign Het
Vwa5b2 A G 16: 20,420,358 (GRCm39) S756G probably damaging Het
Wdr86 A G 5: 24,923,305 (GRCm39) V129A probably benign Het
Zfyve9 A G 4: 108,576,940 (GRCm39) L47S probably benign Het
Other mutations in Wdr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Wdr36 APN 18 32,978,684 (GRCm39) missense possibly damaging 0.86
IGL01975:Wdr36 APN 18 32,985,541 (GRCm39) missense probably damaging 1.00
IGL02001:Wdr36 APN 18 32,985,941 (GRCm39) missense probably damaging 1.00
IGL02605:Wdr36 APN 18 32,985,044 (GRCm39) missense possibly damaging 0.94
IGL02625:Wdr36 APN 18 32,992,314 (GRCm39) missense possibly damaging 0.51
IGL02928:Wdr36 APN 18 32,980,372 (GRCm39) critical splice donor site probably null
R0025:Wdr36 UTSW 18 32,992,360 (GRCm39) missense probably damaging 1.00
R0025:Wdr36 UTSW 18 32,992,360 (GRCm39) missense probably damaging 1.00
R0062:Wdr36 UTSW 18 32,997,802 (GRCm39) missense possibly damaging 0.90
R0062:Wdr36 UTSW 18 32,997,802 (GRCm39) missense possibly damaging 0.90
R0331:Wdr36 UTSW 18 32,985,968 (GRCm39) missense possibly damaging 0.83
R0626:Wdr36 UTSW 18 32,983,584 (GRCm39) missense probably damaging 1.00
R0835:Wdr36 UTSW 18 32,982,135 (GRCm39) missense possibly damaging 0.87
R1484:Wdr36 UTSW 18 32,976,938 (GRCm39) missense possibly damaging 0.77
R1498:Wdr36 UTSW 18 32,986,021 (GRCm39) missense possibly damaging 0.95
R4521:Wdr36 UTSW 18 32,974,201 (GRCm39) splice site probably null
R4902:Wdr36 UTSW 18 32,992,314 (GRCm39) missense possibly damaging 0.51
R5482:Wdr36 UTSW 18 32,974,957 (GRCm39) missense probably benign 0.19
R5574:Wdr36 UTSW 18 32,999,012 (GRCm39) missense probably damaging 1.00
R5627:Wdr36 UTSW 18 32,994,691 (GRCm39) missense possibly damaging 0.73
R6076:Wdr36 UTSW 18 32,979,998 (GRCm39) missense probably damaging 1.00
R6186:Wdr36 UTSW 18 32,985,954 (GRCm39) missense probably benign 0.19
R6228:Wdr36 UTSW 18 32,975,059 (GRCm39) missense possibly damaging 0.67
R7027:Wdr36 UTSW 18 32,974,958 (GRCm39) missense probably benign 0.04
R7112:Wdr36 UTSW 18 32,972,504 (GRCm39) missense probably benign 0.34
R7635:Wdr36 UTSW 18 32,983,578 (GRCm39) missense probably benign 0.19
R7642:Wdr36 UTSW 18 32,987,624 (GRCm39) splice site probably null
R7998:Wdr36 UTSW 18 32,985,572 (GRCm39) missense probably damaging 1.00
R8200:Wdr36 UTSW 18 32,998,979 (GRCm39) missense probably benign 0.10
R8203:Wdr36 UTSW 18 32,985,136 (GRCm39) nonsense probably null
R8257:Wdr36 UTSW 18 32,974,339 (GRCm39) intron probably benign
R8334:Wdr36 UTSW 18 32,992,346 (GRCm39) missense possibly damaging 0.95
R8845:Wdr36 UTSW 18 32,994,098 (GRCm39) nonsense probably null
R8894:Wdr36 UTSW 18 32,970,340 (GRCm39) start gained probably benign
R8901:Wdr36 UTSW 18 32,980,013 (GRCm39) missense probably damaging 1.00
R9044:Wdr36 UTSW 18 32,970,499 (GRCm39) missense probably damaging 1.00
R9181:Wdr36 UTSW 18 32,981,382 (GRCm39) missense possibly damaging 0.83
R9565:Wdr36 UTSW 18 32,994,168 (GRCm39) nonsense probably null
R9800:Wdr36 UTSW 18 32,985,700 (GRCm39) missense possibly damaging 0.94
X0063:Wdr36 UTSW 18 32,997,775 (GRCm39) missense probably damaging 0.96
Z1088:Wdr36 UTSW 18 32,999,065 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGTACTTGTCAAACCCAAGG -3'
(R):5'- ACACTAGAGCAGTACCTTGATAAC -3'

Sequencing Primer
(F):5'- GGTACTTGTCAAACCCAAGGTAATC -3'
(R):5'- CATCAAGATTCAGAAGGTTTTTCCAG -3'
Posted On 2015-02-18