Incidental Mutation 'R3195:Paqr8'
ID267578
Institutional Source Beutler Lab
Gene Symbol Paqr8
Ensembl Gene ENSMUSG00000025931
Gene Nameprogestin and adipoQ receptor family member VIII
Synonyms1700019B16Rik, 3110001D06Rik
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20890606-20939650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20935033 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 137 (E137G)
Ref Sequence ENSEMBL: ENSMUSP00000141054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068880] [ENSMUST00000167119] [ENSMUST00000187651] [ENSMUST00000189400]
Predicted Effect probably damaging
Transcript: ENSMUST00000068880
AA Change: E137G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069127
Gene: ENSMUSG00000025931
AA Change: E137G

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167119
AA Change: E137G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128781
Gene: ENSMUSG00000025931
AA Change: E137G

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.2e-53 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187651
AA Change: E137G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140913
Gene: ENSMUSG00000025931
AA Change: E137G

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189400
AA Change: E137G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141054
Gene: ENSMUSG00000025931
AA Change: E137G

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Meta Mutation Damage Score 0.6979 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Paqr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Paqr8 APN 1 20935404 missense probably damaging 1.00
IGL02720:Paqr8 APN 1 20935509 nonsense probably null
LCD18:Paqr8 UTSW 1 20914658 intron probably benign
R0190:Paqr8 UTSW 1 20935047 missense probably benign 0.00
R0566:Paqr8 UTSW 1 20935463 missense possibly damaging 0.63
R1491:Paqr8 UTSW 1 20934824 missense probably benign
R1885:Paqr8 UTSW 1 20935480 missense probably damaging 1.00
R3751:Paqr8 UTSW 1 20935632 missense probably benign 0.23
R3752:Paqr8 UTSW 1 20935632 missense probably benign 0.23
R3753:Paqr8 UTSW 1 20935632 missense probably benign 0.23
R4748:Paqr8 UTSW 1 20935413 missense probably benign 0.06
R5207:Paqr8 UTSW 1 20935258 missense probably benign 0.00
R5264:Paqr8 UTSW 1 20935108 missense possibly damaging 0.93
R5267:Paqr8 UTSW 1 20934696 missense probably benign
R7389:Paqr8 UTSW 1 20935165 missense probably damaging 1.00
R7468:Paqr8 UTSW 1 20935218 missense probably damaging 1.00
Z1176:Paqr8 UTSW 1 20934798 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTCAGAAGCACAACGAGGTG -3'
(R):5'- TCGGTAGCGATACTTGGCATAAC -3'

Sequencing Primer
(F):5'- GTCAACGTCTGGACCCACTTG -3'
(R):5'- TAGCGATACTTGGCATAACAACAG -3'
Posted On2015-02-18