Incidental Mutation 'R3195:Acnat1'
ID267584
Institutional Source Beutler Lab
Gene Symbol Acnat1
Ensembl Gene ENSMUSG00000070985
Gene Nameacyl-coenzyme A amino acid N-acyltransferase 1
Synonyms
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49447105-49473912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 49447457 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 357 (P357A)
Ref Sequence ENSEMBL: ENSMUSP00000103325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095086] [ENSMUST00000107697] [ENSMUST00000135976]
Predicted Effect probably benign
Transcript: ENSMUST00000095086
AA Change: P375A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000092702
Gene: ENSMUSG00000070985
AA Change: P375A

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 144 2.2e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:Abhydrolase_5 170 360 3.6e-8 PFAM
Pfam:FSH1 191 361 4.5e-7 PFAM
Pfam:BAAT_C 206 411 5.5e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107697
AA Change: P357A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103325
Gene: ENSMUSG00000070985
AA Change: P357A

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 5.7e-42 PFAM
Pfam:Abhydrolase_5 156 342 3.3e-8 PFAM
Pfam:BAAT_C 188 393 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135976
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Acnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Acnat1 APN 4 49447793 missense probably benign
IGL03241:Acnat1 APN 4 49447702 missense probably benign 0.01
R0478:Acnat1 UTSW 4 49450901 missense probably damaging 1.00
R0568:Acnat1 UTSW 4 49451003 missense possibly damaging 0.93
R1299:Acnat1 UTSW 4 49450925 missense possibly damaging 0.94
R1538:Acnat1 UTSW 4 49447835 missense possibly damaging 0.69
R1750:Acnat1 UTSW 4 49451042 missense probably benign 0.08
R1847:Acnat1 UTSW 4 49447716 missense possibly damaging 0.71
R1913:Acnat1 UTSW 4 49447498 missense probably damaging 1.00
R2401:Acnat1 UTSW 4 49451077 missense possibly damaging 0.72
R3196:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3948:Acnat1 UTSW 4 49447477 missense possibly damaging 0.52
R4395:Acnat1 UTSW 4 49447679 missense probably benign 0.00
R4598:Acnat1 UTSW 4 49450781 missense probably benign 0.22
R4774:Acnat1 UTSW 4 49450784 missense probably benign 0.08
R6575:Acnat1 UTSW 4 49450785 missense possibly damaging 0.53
R7545:Acnat1 UTSW 4 49449142 nonsense probably null
R7891:Acnat1 UTSW 4 49449181 missense possibly damaging 0.89
R7974:Acnat1 UTSW 4 49449181 missense possibly damaging 0.89
Z1088:Acnat1 UTSW 4 49447588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGCAATTCCCATCTGATG -3'
(R):5'- TACTTCCCGTGGAAAAGGC -3'

Sequencing Primer
(F):5'- TACAACAATTCCAGCATTTTCGC -3'
(R):5'- AGGCCCAGGGGAAGATCC -3'
Posted On2015-02-18