Mutagenetix > Incidental Mutations

Incidental Mutation 'R3195:Frem1'

267585

Institutional Source

Beutler Lab

Gene Symbol

Frem1

Ensembl Gene

ENSMUSG00000059049

Gene Name

Fras1 related extracellular matrix protein 1

Synonyms

eyes2, heb, eye, crf11, QBRICK

MMRRC Submission

040616-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.731) question?

Stock #

R3195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82897920-83052339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83014114 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 117 (F117L)

Ref Sequence

ENSEMBL: ENSMUSP00000125809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071708
AA Change: F117L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: F117L

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	364	508	1.7e-37	PFAM
Pfam:Cadherin_3	509	623	3.7e-18	PFAM
Pfam:Cadherin_3	592	709	8.4e-16	PFAM
Pfam:Cadherin_3	746	894	4.8e-26	PFAM
Pfam:Cadherin_3	863	1009	2.8e-30	PFAM
Pfam:Cadherin_3	1024	1115	6.4e-13	PFAM
Pfam:Cadherin_3	1119	1252	1.4e-17	PFAM
Pfam:Cadherin_3	1243	1393	8.2e-35	PFAM
Pfam:Cadherin_3	1378	1506	2e-22	PFAM
Pfam:Cadherin_3	1506	1616	1e-29	PFAM
Pfam:Cadherin_3	1617	1744	1.5e-14	PFAM
Pfam:Calx-beta	1749	1848	2.6e-10	PFAM
low complexity region	1894	1910	N/A	INTRINSIC
CLECT	2065	2188	2.25e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107230
AA Change: F117L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: F117L

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
internal_repeat_1	296	967	9.01e-39	PROSPERO
internal_repeat_1	1026	1705	9.01e-39	PROSPERO
Pfam:Calx-beta	1730	1829	6.7e-10	PFAM
low complexity region	1875	1891	N/A	INTRINSIC
CLECT	2046	2169	2.25e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131102

Predicted Effect

probably damaging
Transcript: ENSMUST00000170248
AA Change: F117L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: F117L

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	365	509	1.3e-37	PFAM
Pfam:Cadherin_3	510	623	4.5e-18	PFAM
Pfam:Cadherin_3	593	711	6.1e-16	PFAM
Pfam:Cadherin_3	728	876	2.7e-27	PFAM
Pfam:Cadherin_3	845	991	2.1e-30	PFAM
Pfam:Cadherin_3	1006	1097	4.8e-13	PFAM
Pfam:Cadherin_3	1101	1234	1e-17	PFAM
Pfam:Cadherin_3	1225	1375	6.1e-35	PFAM
Pfam:Cadherin_3	1360	1488	1.5e-22	PFAM
Pfam:Cadherin_3	1488	1598	7.5e-30	PFAM
Pfam:Cadherin_3	1599	1726	1.1e-14	PFAM
Pfam:Calx-beta	1731	1830	6.4e-10	PFAM
low complexity region	1876	1892	N/A	INTRINSIC
CLECT	2047	2170	2.25e-27	SMART

Meta Mutation Damage Score

0.1333

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,028,736	N158K	probably benign	Het
Acnat1	G	C	4: 49,447,457	P357A	probably damaging	Het
Akap6	T	A	12: 53,072,457	C1102*	probably null	Het
Calb2	C	T	8: 110,157,003		probably benign	Het
Cdh15	G	A	8: 122,856,635	R59H	probably benign	Het
Csgalnact1	TGG	TG	8: 68,461,085		probably null	Het
Dmtf1	A	G	5: 9,132,454		probably benign	Het
Focad	A	G	4: 88,407,351	E151G	possibly damaging	Het
Gab2	A	G	7: 97,272,029	T204A	probably benign	Het
Gapdh	T	C	6: 125,162,620	N229S	possibly damaging	Het
Gm3604	A	T	13: 62,370,054	C163*	probably null	Het
Iqub	G	C	6: 24,462,037		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
L1td1	A	G	4: 98,737,518	E650G	possibly damaging	Het
Lilra5	G	A	7: 4,238,757	G185D	probably damaging	Het
Lpin1	A	G	12: 16,565,583	S323P	possibly damaging	Het
Mmp7	C	A	9: 7,692,218	S31R	probably benign	Het
Myo1h	G	A	5: 114,328,740	C283Y	probably benign	Het
Nfkbiz	A	G	16: 55,819,628	L122P	probably damaging	Het
Olfr395	T	C	11: 73,906,658	Y278C	possibly damaging	Het
Olfr95	A	G	17: 37,211,536	F106L	possibly damaging	Het
Paqr8	A	G	1: 20,935,033	E137G	probably damaging	Het
Pde4b	G	A	4: 102,599,643	A429T	probably damaging	Het
Pes1	T	C	11: 3,975,736		probably benign	Het
Reln	A	T	5: 22,040,420	I730N	possibly damaging	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Skint9	T	G	4: 112,390,951	I199L	probably benign	Het
Slc13a4	C	T	6: 35,268,926	V595M	probably damaging	Het
Smarca2	A	G	19: 26,683,822	E939G	possibly damaging	Het
Spg11	A	G	2: 122,083,398		probably null	Het
Trpm1	T	A	7: 64,199,313	Y102*	probably null	Het
Usp42	A	G	5: 143,717,199	S556P	probably benign	Het
Zfp957	A	G	14: 79,212,892	V489A	probably damaging	Het

Other mutations in Frem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Frem1	APN	4	82959389	missense	possibly damaging	0.46
IGL01069:Frem1	APN	4	83013867	missense	probably benign	0.00
IGL01106:Frem1	APN	4	82922257	missense	probably benign	0.00
IGL01398:Frem1	APN	4	82950362	missense	possibly damaging	0.64
IGL01617:Frem1	APN	4	82936139	missense	probably benign	0.02
IGL01647:Frem1	APN	4	82950356	missense	possibly damaging	0.60
IGL01690:Frem1	APN	4	82959296	splice site	probably benign
IGL02006:Frem1	APN	4	82992800	critical splice donor site	probably null
IGL02069:Frem1	APN	4	82903551	missense	probably damaging	1.00
IGL02131:Frem1	APN	4	82924854	missense	probably benign	0.03
IGL02225:Frem1	APN	4	82940506	missense	probably damaging	1.00
IGL02439:Frem1	APN	4	82956345	missense	probably benign	0.00
IGL02567:Frem1	APN	4	83000055	missense	probably damaging	1.00
IGL02647:Frem1	APN	4	83001754	missense	probably damaging	1.00
IGL02653:Frem1	APN	4	82959334	missense	probably benign	0.22
IGL02831:Frem1	APN	4	82956158	missense	probably benign	0.31
IGL02997:Frem1	APN	4	82934968	missense	probably damaging	1.00
IGL03005:Frem1	APN	4	82994134	missense	probably damaging	1.00
IGL03036:Frem1	APN	4	82959339	missense	possibly damaging	0.55
IGL03193:Frem1	APN	4	82994026	splice site	probably benign
IGL03218:Frem1	APN	4	82914646	missense	probably benign	0.00
IGL03235:Frem1	APN	4	83020755	missense	possibly damaging	0.87
IGL03243:Frem1	APN	4	83013969	missense	probably damaging	1.00
bat	UTSW	4	82983060	intron	probably benign
PIT4131001:Frem1	UTSW	4	83005808	missense	probably damaging	0.99
PIT4466001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4472001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4515001:Frem1	UTSW	4	82900426	missense	probably damaging	0.98
PIT4531001:Frem1	UTSW	4	82950280	missense	probably benign	0.12
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0115:Frem1	UTSW	4	82936169	missense	possibly damaging	0.94
R0125:Frem1	UTSW	4	83011951	missense	probably damaging	1.00
R0280:Frem1	UTSW	4	82969444	missense	probably damaging	1.00
R0504:Frem1	UTSW	4	82912637	missense	probably benign	0.26
R0519:Frem1	UTSW	4	82970633	critical splice donor site	probably null
R0631:Frem1	UTSW	4	82972165	missense	probably damaging	1.00
R0645:Frem1	UTSW	4	82989166	missense	probably damaging	1.00
R0781:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1110:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1115:Frem1	UTSW	4	83020770	missense	probably benign	0.28
R1130:Frem1	UTSW	4	82916628	splice site	probably null
R1173:Frem1	UTSW	4	82950352	missense	probably benign	0.16
R1349:Frem1	UTSW	4	82922305	splice site	probably benign
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1658:Frem1	UTSW	4	83001808	missense	probably damaging	1.00
R1672:Frem1	UTSW	4	82998891	missense	probably benign	0.09
R1831:Frem1	UTSW	4	83020837	missense	possibly damaging	0.95
R1851:Frem1	UTSW	4	82950500	missense	probably damaging	0.98
R2014:Frem1	UTSW	4	83005852	missense	probably damaging	1.00
R2021:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2022:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2023:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2183:Frem1	UTSW	4	82991495	missense	probably benign	0.00
R2437:Frem1	UTSW	4	83000173	missense	probably damaging	1.00
R2520:Frem1	UTSW	4	82950290	missense	probably damaging	0.99
R3196:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3408:Frem1	UTSW	4	83011986	missense	probably damaging	1.00
R3411:Frem1	UTSW	4	82963179	missense	possibly damaging	0.51
R3742:Frem1	UTSW	4	83011867	missense	probably damaging	1.00
R3829:Frem1	UTSW	4	82998930	missense	probably damaging	1.00
R3888:Frem1	UTSW	4	82913607	missense	probably benign	0.41
R4329:Frem1	UTSW	4	82986537	missense	probably benign	0.01
R4364:Frem1	UTSW	4	82913251	missense	probably damaging	0.99
R4411:Frem1	UTSW	4	82963244	missense	probably damaging	1.00
R4624:Frem1	UTSW	4	82989106	missense	probably damaging	1.00
R4687:Frem1	UTSW	4	83020631	missense	probably damaging	1.00
R4764:Frem1	UTSW	4	82989189	missense	probably damaging	1.00
R4801:Frem1	UTSW	4	82916628	splice site	probably benign
R4802:Frem1	UTSW	4	82916628	splice site	probably benign
R4854:Frem1	UTSW	4	82916758	missense	possibly damaging	0.88
R4872:Frem1	UTSW	4	82963150	missense	probably damaging	1.00
R4947:Frem1	UTSW	4	82966134	missense	probably damaging	0.99
R5007:Frem1	UTSW	4	82940812	intron	probably benign
R5103:Frem1	UTSW	4	82991612	missense	probably benign
R5369:Frem1	UTSW	4	83001739	missense	possibly damaging	0.61
R5494:Frem1	UTSW	4	82940753	makesense	probably null
R5694:Frem1	UTSW	4	82994116	missense	probably damaging	1.00
R5780:Frem1	UTSW	4	82950415	missense	probably benign	0.12
R5813:Frem1	UTSW	4	83000158	missense	probably damaging	1.00
R5843:Frem1	UTSW	4	82936052	missense	probably damaging	1.00
R5914:Frem1	UTSW	4	83001775	missense	probably damaging	1.00
R5985:Frem1	UTSW	4	82966050	missense	probably benign
R6091:Frem1	UTSW	4	82900559	missense	probably benign	0.01
R6165:Frem1	UTSW	4	82956255	missense	probably benign	0.16
R6324:Frem1	UTSW	4	82983337	missense	probably benign	0.00
R6369:Frem1	UTSW	4	82913792	splice site	probably null
R6414:Frem1	UTSW	4	82940536	missense	probably damaging	0.98
R6421:Frem1	UTSW	4	82994128	missense	probably damaging	1.00
R6434:Frem1	UTSW	4	82966016	missense	probably benign	0.03
R6453:Frem1	UTSW	4	82914825	nonsense	probably null
R6598:Frem1	UTSW	4	83013828	missense	probably damaging	0.99
R6720:Frem1	UTSW	4	83013832	missense	probably damaging	0.98
R6862:Frem1	UTSW	4	83012014	nonsense	probably null
R6922:Frem1	UTSW	4	82922269	missense	probably damaging	1.00
R6931:Frem1	UTSW	4	82970677	missense	probably damaging	1.00
R6992:Frem1	UTSW	4	82940362	missense	possibly damaging	0.62
R6995:Frem1	UTSW	4	82986601	missense	probably damaging	1.00
R7001:Frem1	UTSW	4	82986561	missense	probably benign	0.44
R7104:Frem1	UTSW	4	82940681	missense	probably benign	0.30
R7146:Frem1	UTSW	4	82922295	missense	possibly damaging	0.93
R7174:Frem1	UTSW	4	82922256	missense	probably benign	0.00
R7327:Frem1	UTSW	4	83020755	missense	possibly damaging	0.87
R7343:Frem1	UTSW	4	82994122	missense	probably damaging	0.99
R7368:Frem1	UTSW	4	82966144	missense	probably benign	0.19
R7392:Frem1	UTSW	4	83013827	missense	probably benign	0.06
R7465:Frem1	UTSW	4	82914835	missense	probably benign	0.11
R7499:Frem1	UTSW	4	83005770	missense	probably damaging	1.00
R7536:Frem1	UTSW	4	82956195	missense	probably damaging	1.00
R7752:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7753:Frem1	UTSW	4	82913980	missense	probably benign	0.03
R7790:Frem1	UTSW	4	82989164	missense	probably benign	0.02
R7818:Frem1	UTSW	4	83014008	missense	probably damaging	1.00
R7877:Frem1	UTSW	4	83013812	critical splice donor site	probably null
R7878:Frem1	UTSW	4	83020680	missense	probably benign	0.00
R7886:Frem1	UTSW	4	83016406	missense	possibly damaging	0.68
R7901:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7976:Frem1	UTSW	4	83001709	missense	probably damaging	0.97
R8240:Frem1	UTSW	4	82956248	missense	probably benign	0.21
R8305:Frem1	UTSW	4	82999989	missense	probably benign	0.06
R8415:Frem1	UTSW	4	83000262	missense	probably damaging	1.00
X0013:Frem1	UTSW	4	82914808	missense	probably benign	0.38
X0017:Frem1	UTSW	4	82991633	critical splice acceptor site	probably null
Z1088:Frem1	UTSW	4	82972267	missense	probably damaging	1.00
Z1176:Frem1	UTSW	4	82999983	missense	probably damaging	1.00
Z1177:Frem1	UTSW	4	82940315	critical splice donor site	probably null
Z1177:Frem1	UTSW	4	83000269	missense	probably benign	0.39
Z1177:Frem1	UTSW	4	83016464	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGGCAGTCCTATCATAATC -3'
(R):5'- GTCTGAGCCTGAATGGAAGG -3'

Sequencing Primer
(F):5'- CAAACTGGAGCAGGTTCTTATC -3'
(R):5'- ATGCTGTTAAGATCCTGGCTC -3'

Posted On

2015-02-18