Incidental Mutation 'R3195:L1td1'
ID267587
Institutional Source Beutler Lab
Gene Symbol L1td1
Ensembl Gene ENSMUSG00000087166
Gene NameLINE-1 type transposase domain containing 1
SynonymsECAT11
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98726734-98738480 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98737518 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 650 (E650G)
Ref Sequence ENSEMBL: ENSMUSP00000134149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000152889] [ENSMUST00000154279] [ENSMUST00000171708] [ENSMUST00000173659]
Predicted Effect probably benign
Transcript: ENSMUST00000152889
Predicted Effect possibly damaging
Transcript: ENSMUST00000154279
AA Change: E584G

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127504
Gene: ENSMUSG00000087166
AA Change: E584G

DomainStartEndE-ValueType
Pfam:Transposase_22 175 295 4e-21 PFAM
low complexity region 346 397 N/A INTRINSIC
low complexity region 402 413 N/A INTRINSIC
Pfam:Transposase_22 495 782 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171708
Predicted Effect possibly damaging
Transcript: ENSMUST00000173659
AA Change: E650G

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134149
Gene: ENSMUSG00000087166
AA Change: E650G

DomainStartEndE-ValueType
Pfam:Transposase_22 175 291 6e-20 PFAM
coiled coil region 383 431 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Pfam:Transposase_22 568 848 4.3e-57 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal development and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in L1td1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:L1td1 APN 4 98737344 missense probably damaging 0.99
IGL02529:L1td1 APN 4 98737421 missense probably benign 0.01
R0254:L1td1 UTSW 4 98737182 nonsense probably null
R0924:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R0930:L1td1 UTSW 4 98737625 missense probably damaging 1.00
R1434:L1td1 UTSW 4 98737817 missense possibly damaging 0.91
R1573:L1td1 UTSW 4 98737280 missense probably benign 0.01
R1751:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1767:L1td1 UTSW 4 98737449 missense probably benign 0.32
R1870:L1td1 UTSW 4 98737477 missense possibly damaging 0.93
R2006:L1td1 UTSW 4 98733489 missense possibly damaging 0.53
R2252:L1td1 UTSW 4 98737637 unclassified probably null
R2383:L1td1 UTSW 4 98737722 missense possibly damaging 0.93
R2472:L1td1 UTSW 4 98733159 unclassified probably benign
R3763:L1td1 UTSW 4 98737835 missense probably damaging 0.99
R3950:L1td1 UTSW 4 98737353 missense probably benign 0.12
R3962:L1td1 UTSW 4 98737449 missense probably benign 0.32
R4430:L1td1 UTSW 4 98737151 missense probably benign 0.00
R4643:L1td1 UTSW 4 98737883 missense probably damaging 0.98
R4661:L1td1 UTSW 4 98733624 missense possibly damaging 0.94
R4885:L1td1 UTSW 4 98737311 missense probably benign 0.01
R5345:L1td1 UTSW 4 98736447 missense probably damaging 1.00
R5589:L1td1 UTSW 4 98738104 missense possibly damaging 0.66
R5800:L1td1 UTSW 4 98733762 missense possibly damaging 0.96
R6207:L1td1 UTSW 4 98737418 missense possibly damaging 0.55
R6309:L1td1 UTSW 4 98737091 missense probably damaging 0.99
R6917:L1td1 UTSW 4 98734031 missense probably benign 0.18
R6945:L1td1 UTSW 4 98733696 missense probably benign 0.33
R7185:L1td1 UTSW 4 98736618 missense possibly damaging 0.72
R7258:L1td1 UTSW 4 98736864 missense probably benign 0.04
R7893:L1td1 UTSW 4 98733741 missense possibly damaging 0.73
R7976:L1td1 UTSW 4 98733741 missense possibly damaging 0.73
RF019:L1td1 UTSW 4 98736824 missense not run
RF031:L1td1 UTSW 4 98736789 small deletion probably benign
RF039:L1td1 UTSW 4 98736789 small deletion probably benign
RF060:L1td1 UTSW 4 98736794 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTTGATCCTTGAAACCGAAGAAAAC -3'
(R):5'- TTTGGTGGACAGAGAGCACTC -3'

Sequencing Primer
(F):5'- ACTTCAAGAGAGGCGTGATC -3'
(R):5'- GTGCTCATCCACTGAATTAGGGAC -3'
Posted On2015-02-18