Incidental Mutation 'R3195:Myo1h'
ID267593
Institutional Source Beutler Lab
Gene Symbol Myo1h
Ensembl Gene ENSMUSG00000066952
Gene Namemyosin 1H
Synonyms4631401O15Rik
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114289166-114365357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114328740 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 283 (C283Y)
Ref Sequence ENSEMBL: ENSMUSP00000144110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124316] [ENSMUST00000169347] [ENSMUST00000202006]
Predicted Effect probably benign
Transcript: ENSMUST00000124316
AA Change: C283Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952
AA Change: C283Y

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169347
AA Change: C299Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952
AA Change: C299Y

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202006
AA Change: C283Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952
AA Change: C283Y

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Myo1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myo1h APN 5 114315071 splice site probably benign
IGL00922:Myo1h APN 5 114360485 missense probably damaging 1.00
IGL01022:Myo1h APN 5 114336300 missense possibly damaging 0.67
IGL01364:Myo1h APN 5 114348439 missense probably damaging 1.00
IGL01469:Myo1h APN 5 114361269 missense probably damaging 1.00
IGL01626:Myo1h APN 5 114314966 missense probably damaging 1.00
IGL02026:Myo1h APN 5 114323444 missense probably null 0.07
IGL02156:Myo1h APN 5 114353911 splice site probably benign
IGL02164:Myo1h APN 5 114334096 missense probably damaging 1.00
IGL02429:Myo1h APN 5 114359738 splice site probably benign
IGL02562:Myo1h APN 5 114357992 missense probably benign 0.06
IGL02938:Myo1h APN 5 114358939 missense probably damaging 1.00
R0056:Myo1h UTSW 5 114330212 missense probably damaging 1.00
R0172:Myo1h UTSW 5 114329164 splice site probably null
R0346:Myo1h UTSW 5 114355209 missense probably benign 0.19
R0464:Myo1h UTSW 5 114360510 missense probably damaging 1.00
R0556:Myo1h UTSW 5 114319791 missense probably damaging 1.00
R0723:Myo1h UTSW 5 114319680 missense probably benign 0.20
R0751:Myo1h UTSW 5 114320686 missense probably damaging 1.00
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1579:Myo1h UTSW 5 114347435 nonsense probably null
R1646:Myo1h UTSW 5 114317632 missense possibly damaging 0.90
R1648:Myo1h UTSW 5 114336275 missense probably damaging 1.00
R1981:Myo1h UTSW 5 114353837 missense probably damaging 1.00
R2006:Myo1h UTSW 5 114361079 missense probably damaging 1.00
R2697:Myo1h UTSW 5 114355213 missense probably damaging 1.00
R3124:Myo1h UTSW 5 114328799 missense probably benign 0.04
R4255:Myo1h UTSW 5 114330137 missense possibly damaging 0.89
R4613:Myo1h UTSW 5 114348379 missense possibly damaging 0.73
R4613:Myo1h UTSW 5 114351676 missense probably benign 0.02
R4758:Myo1h UTSW 5 114349582 missense probably damaging 1.00
R4784:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R4785:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R5511:Myo1h UTSW 5 114345897 nonsense probably null
R5663:Myo1h UTSW 5 114334094 missense probably damaging 1.00
R6186:Myo1h UTSW 5 114319803 missense possibly damaging 0.90
R6243:Myo1h UTSW 5 114362147 missense probably damaging 1.00
R6344:Myo1h UTSW 5 114328715 missense probably damaging 1.00
R6345:Myo1h UTSW 5 114351708 missense probably damaging 1.00
R6383:Myo1h UTSW 5 114336264 missense probably damaging 1.00
R6444:Myo1h UTSW 5 114314956 missense possibly damaging 0.63
R6787:Myo1h UTSW 5 114320653 missense probably damaging 1.00
R6891:Myo1h UTSW 5 114349612 missense probably damaging 1.00
R6990:Myo1h UTSW 5 114330160 missense probably damaging 0.97
R7040:Myo1h UTSW 5 114359744 missense possibly damaging 0.67
R7101:Myo1h UTSW 5 114342197 missense
R7121:Myo1h UTSW 5 114338229 missense
R7206:Myo1h UTSW 5 114319775 nonsense probably null
R7222:Myo1h UTSW 5 114355261 critical splice donor site probably null
R7921:Myo1h UTSW 5 114328811 splice site probably null
R7979:Myo1h UTSW 5 114336311 splice site probably null
R8004:Myo1h UTSW 5 114320708 missense
Z1177:Myo1h UTSW 5 114334156 missense
Predicted Primers PCR Primer
(F):5'- CCCCATTAAGATAATTAGCACTGG -3'
(R):5'- TCGCTGGTTGAAGCTCTAACC -3'

Sequencing Primer
(F):5'- GTGACCAGGACCCATTACTATCGAG -3'
(R):5'- CCTCCTAACCATGAAAGAGTGTGG -3'
Posted On2015-02-18