Incidental Mutation 'R3195:Gapdh'
ID267597
Institutional Source Beutler Lab
Gene Symbol Gapdh
Ensembl Gene ENSMUSG00000057666
Gene Nameglyceraldehyde-3-phosphate dehydrogenase
SynonymsGapd, Gapd
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3195 (G1)
Quality Score145
Status Not validated
Chromosome6
Chromosomal Location125161715-125166467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125162620 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 229 (N229S)
Ref Sequence ENSEMBL: ENSMUSP00000113942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073605] [ENSMUST00000117675] [ENSMUST00000117757] [ENSMUST00000118875] [ENSMUST00000119527] [ENSMUST00000144364] [ENSMUST00000182052] [ENSMUST00000182277] [ENSMUST00000183272]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073605
AA Change: N203S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073289
Gene: ENSMUSG00000057666
AA Change: N203S

DomainStartEndE-ValueType
Gp_dh_N 2 143 4.2e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117675
SMART Domains Protein: ENSMUSP00000113088
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
PDB:1GK4|F 393 459 6e-7 PDB
low complexity region 474 497 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117757
AA Change: N229S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113942
Gene: ENSMUSG00000057666
AA Change: N229S

DomainStartEndE-ValueType
Gp_dh_N 2 150 7.33e-109 SMART
Pfam:Gp_dh_C 155 312 5.2e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118875
AA Change: N203S

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113213
Gene: ENSMUSG00000057666
AA Change: N203S

DomainStartEndE-ValueType
Gp_dh_N 2 150 7.33e-109 SMART
Pfam:Gp_dh_C 155 312 7.4e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119527
SMART Domains Protein: ENSMUSP00000113376
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
PDB:1GK4|F 390 456 6e-7 PDB
low complexity region 471 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144205
Predicted Effect probably benign
Transcript: ENSMUST00000144364
SMART Domains Protein: ENSMUSP00000116701
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147954
Predicted Effect probably benign
Transcript: ENSMUST00000148835
SMART Domains Protein: ENSMUSP00000115080
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
Filament 34 348 4.99e-2 SMART
low complexity region 356 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150474
Predicted Effect probably benign
Transcript: ENSMUST00000182052
SMART Domains Protein: ENSMUSP00000138403
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 1 55 2.96e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182115
Predicted Effect probably benign
Transcript: ENSMUST00000182277
SMART Domains Protein: ENSMUSP00000138295
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 2 57 2.75e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182670
Predicted Effect possibly damaging
Transcript: ENSMUST00000183272
AA Change: N160S

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138508
Gene: ENSMUSG00000057666
AA Change: N160S

DomainStartEndE-ValueType
Gp_dh_N 2 107 7.93e-64 SMART
Pfam:Gp_dh_C 112 269 3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192506
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein was originally identified as a key glycolytic enzyme that converts D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate. Subsequent studies have assigned a variety of additional functions to the protein including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Alternative splicing results in multiple transcript variants. Many pseudogenes similar to this locus are found throughout the mouse genome. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant heterozygotes show reduced enzyme levels. The currently known mutant allels are homozygous lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Gapdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Gapdh APN 6 125162507 missense probably damaging 0.99
R2203:Gapdh UTSW 6 125162606 missense probably benign 0.18
R4181:Gapdh UTSW 6 125165234 intron probably benign
R4480:Gapdh UTSW 6 125163182 missense possibly damaging 0.55
R5934:Gapdh UTSW 6 125162701 missense probably damaging 0.98
R6019:Gapdh UTSW 6 125163033 nonsense probably null
R6034:Gapdh UTSW 6 125165298 missense probably benign 0.25
R6212:Gapdh UTSW 6 125162698 missense probably damaging 1.00
R6776:Gapdh UTSW 6 125162273 missense probably damaging 1.00
R6928:Gapdh UTSW 6 125162671 missense probably damaging 1.00
R7188:Gapdh UTSW 6 125165440 intron probably benign
R7330:Gapdh UTSW 6 125162937 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCCCAAGTCACTGTCACAC -3'
(R):5'- GGGAGACAGCTCATGCATTTC -3'

Sequencing Primer
(F):5'- GTCACTGTCACACCAGAGAC -3'
(R):5'- GGGAGACAGCTCATGCATTTCTTATC -3'
Posted On2015-02-18