Mutagenetix > Incidental Mutation

Incidental Mutation 'R3195:Csgalnact1'

267602

Institutional Source

Beutler Lab

Gene Symbol

Csgalnact1

Ensembl Gene

ENSMUSG00000036356

Gene Name

chondroitin sulfate N-acetylgalactosaminyltransferase 1

Synonyms

CSGalNAcT-1, 4732435N03Rik

MMRRC Submission

040616-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R3195 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

68356781-68735146 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TGG to TG at 68461085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]

AlphaFold

Q8BJQ9

Predicted Effect

probably null
Transcript: ENSMUST00000078350

SMART Domains

Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	55	505	3.5e-85	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.2e-10	PFAM
Pfam:Glyco_transf_7C	409	478	1.7e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130214

SMART Domains

Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	71	505	1.1e-59	PFAM
Pfam:Glyco_tranf_2_2	263	478	3.6e-10	PFAM
Pfam:Glyco_transf_7C	405	478	3.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132076

Predicted Effect

probably null
Transcript: ENSMUST00000136060

SMART Domains

Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:CHGN	66	300	1.6e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143586

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211871

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

97% (33/34)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,028,736	N158K	probably benign	Het
Acnat1	G	C	4: 49,447,457	P357A	probably damaging	Het
Akap6	T	A	12: 53,072,457	C1102*	probably null	Het
Calb2	C	T	8: 110,157,003		probably benign	Het
Cdh15	G	A	8: 122,856,635	R59H	probably benign	Het
Dmtf1	A	G	5: 9,132,454		probably benign	Het
Focad	A	G	4: 88,407,351	E151G	possibly damaging	Het
Frem1	A	G	4: 83,014,114	F117L	probably damaging	Het
Gab2	A	G	7: 97,272,029	T204A	probably benign	Het
Gapdh	T	C	6: 125,162,620	N229S	possibly damaging	Het
Gm3604	A	T	13: 62,370,054	C163*	probably null	Het
Iqub	G	C	6: 24,462,037		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
L1td1	A	G	4: 98,737,518	E650G	possibly damaging	Het
Lilra5	G	A	7: 4,238,757	G185D	probably damaging	Het
Lpin1	A	G	12: 16,565,583	S323P	possibly damaging	Het
Mmp7	C	A	9: 7,692,218	S31R	probably benign	Het
Myo1h	G	A	5: 114,328,740	C283Y	probably benign	Het
Nfkbiz	A	G	16: 55,819,628	L122P	probably damaging	Het
Olfr395	T	C	11: 73,906,658	Y278C	possibly damaging	Het
Olfr95	A	G	17: 37,211,536	F106L	possibly damaging	Het
Paqr8	A	G	1: 20,935,033	E137G	probably damaging	Het
Pde4b	G	A	4: 102,599,643	A429T	probably damaging	Het
Pes1	T	C	11: 3,975,736		probably benign	Het
Reln	A	T	5: 22,040,420	I730N	possibly damaging	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Skint9	T	G	4: 112,390,951	I199L	probably benign	Het
Slc13a4	C	T	6: 35,268,926	V595M	probably damaging	Het
Smarca2	A	G	19: 26,683,822	E939G	possibly damaging	Het
Spg11	A	G	2: 122,083,398		probably null	Het
Trpm1	T	A	7: 64,199,313	Y102*	probably null	Het
Usp42	A	G	5: 143,717,199	S556P	probably benign	Het
Zfp957	A	G	14: 79,212,892	V489A	probably damaging	Het

Other mutations in Csgalnact1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02015:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02025:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02037:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02059:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02074:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02079:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02080:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02094:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02127:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02128:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02157:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02158:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02197:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02201:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02206:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02207:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02214:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02215:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02229:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02243:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02247:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02248:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02250:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02389:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02394:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02397:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02398:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02400:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02404:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02405:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02406:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02420:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02425:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02428:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02436:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02437:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02438:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02468:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02470:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02472:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02473:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02474:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02475:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02510:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02529:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02530:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02531:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02533:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02543:Csgalnact1	APN	8	68461068	missense	probably damaging	1.00
IGL02620:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02625:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02671:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02674:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02683:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02685:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02686:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02697:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02698:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02741:Csgalnact1	APN	8	68401492	missense	probably damaging	1.00
IGL02985:Csgalnact1	APN	8	68461043	missense	probably benign	0.02
R0173:Csgalnact1	UTSW	8	68461029	missense	probably damaging	1.00
R1594:Csgalnact1	UTSW	8	68358632	missense	probably damaging	1.00
R1655:Csgalnact1	UTSW	8	68373689	missense	possibly damaging	0.89
R1873:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R1955:Csgalnact1	UTSW	8	68372667	missense	probably benign
R2421:Csgalnact1	UTSW	8	68461508	missense	probably benign	0.42
R3196:Csgalnact1	UTSW	8	68461085	frame shift	probably null
R3951:Csgalnact1	UTSW	8	68461262	missense	probably benign
R4304:Csgalnact1	UTSW	8	68372642	missense	possibly damaging	0.94
R4989:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5133:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5134:Csgalnact1	UTSW	8	68460971	missense	probably benign	0.01
R5503:Csgalnact1	UTSW	8	68461473	missense	probably damaging	0.98
R5812:Csgalnact1	UTSW	8	68401384	missense	probably benign	0.02
R6143:Csgalnact1	UTSW	8	68373550	missense	probably damaging	1.00
R6387:Csgalnact1	UTSW	8	68358713	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461109	missense	probably damaging	1.00
R6476:Csgalnact1	UTSW	8	68461110	missense	probably damaging	1.00
R7023:Csgalnact1	UTSW	8	68358429	missense	probably benign
R8318:Csgalnact1	UTSW	8	68461133	missense	probably damaging	1.00
R8446:Csgalnact1	UTSW	8	68461091	missense	probably damaging	0.99
R8519:Csgalnact1	UTSW	8	68401453	missense	possibly damaging	0.65
R8674:Csgalnact1	UTSW	8	68373616	missense	possibly damaging	0.91
R8782:Csgalnact1	UTSW	8	68358655	missense	probably damaging	1.00
R9210:Csgalnact1	UTSW	8	68461589	start gained	probably benign
Z1088:Csgalnact1	UTSW	8	68401330	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGCCAACCTTCTATGAAGTC -3'
(R):5'- CTAAAGGATGAACTGCAGGCAC -3'

Sequencing Primer
(F):5'- AACCTTCTATGAAGTCTGCAGCTG -3'
(R):5'- AGTGAGCAGTTCCGCAGTG -3'

Posted On

2015-02-18