Incidental Mutation 'R3195:Zfp957'
ID267613
Institutional Source Beutler Lab
Gene Symbol Zfp957
Ensembl Gene ENSMUSG00000071262
Gene Namezinc finger protein 957
SynonymsAU017455
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R3195 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location79212355-79247369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79212892 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 489 (V489A)
Ref Sequence ENSEMBL: ENSMUSP00000124930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040802] [ENSMUST00000161649]
Predicted Effect probably damaging
Transcript: ENSMUST00000040802
AA Change: V489A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039470
Gene: ENSMUSG00000071262
AA Change: V489A

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161649
AA Change: V489A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124930
Gene: ENSMUSG00000071262
AA Change: V489A

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 29 53 N/A INTRINSIC
low complexity region 147 161 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
AT_hook 255 267 4.76e0 SMART
AT_hook 298 310 4.76e0 SMART
AT_hook 348 360 2.48e0 SMART
low complexity region 390 398 N/A INTRINSIC
AT_hook 422 434 5.38e0 SMART
PHD 507 554 1.18e-6 SMART
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Nfkbiz A G 16: 55,819,628 L122P probably damaging Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Other mutations in Zfp957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Zfp957 APN 14 79213398 missense unknown
IGL01646:Zfp957 APN 14 79213891 missense probably benign 0.00
IGL02692:Zfp957 APN 14 79213385 missense unknown
R0632:Zfp957 UTSW 14 79212920 missense probably damaging 1.00
R1018:Zfp957 UTSW 14 79212742 missense probably damaging 1.00
R1719:Zfp957 UTSW 14 79213996 missense probably damaging 1.00
R2165:Zfp957 UTSW 14 79213613 missense probably benign 0.06
R2411:Zfp957 UTSW 14 79214342 missense unknown
R2517:Zfp957 UTSW 14 79214054 missense probably damaging 0.99
R4825:Zfp957 UTSW 14 79214356 start codon destroyed probably null
R4881:Zfp957 UTSW 14 79213409 missense unknown
R5138:Zfp957 UTSW 14 79212922 missense probably damaging 1.00
R5174:Zfp957 UTSW 14 79213388 missense unknown
R5531:Zfp957 UTSW 14 79213182 missense unknown
R5547:Zfp957 UTSW 14 79213966 missense probably benign 0.03
R5677:Zfp957 UTSW 14 79212767 missense probably damaging 1.00
R5968:Zfp957 UTSW 14 79214056 missense probably damaging 1.00
R6897:Zfp957 UTSW 14 79213904 missense probably damaging 0.98
R6994:Zfp957 UTSW 14 79213690 missense probably damaging 0.99
R7105:Zfp957 UTSW 14 79212962 missense probably benign 0.09
R7214:Zfp957 UTSW 14 79213310 missense unknown
R7264:Zfp957 UTSW 14 79213640 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTCACTGAGAAATTCTCCTC -3'
(R):5'- AAAGACTCTGCTGGAGGTCC -3'

Sequencing Primer
(F):5'- ACTGAGAAATTCTCCTCATTCAGC -3'
(R):5'- GGTCGCCCTCGTAAAAATGTAGC -3'
Posted On2015-02-18