Incidental Mutation 'R3195:Nfkbiz'
ID267615
Institutional Source Beutler Lab
Gene Symbol Nfkbiz
Ensembl Gene ENSMUSG00000035356
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
SynonymsMail
MMRRC Submission 040616-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R3195 (G1)
Quality Score188
Status Validated
Chromosome16
Chromosomal Location55811375-55838899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55819628 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 122 (L122P)
Ref Sequence ENSEMBL: ENSMUSP00000110102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036273] [ENSMUST00000096026] [ENSMUST00000114457] [ENSMUST00000114458]
Predicted Effect probably damaging
Transcript: ENSMUST00000036273
AA Change: L122P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041173
Gene: ENSMUSG00000035356
AA Change: L122P

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096026
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093726
Gene: ENSMUSG00000035356
AA Change: L23P

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114457
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110101
Gene: ENSMUSG00000035356
AA Change: L23P

DomainStartEndE-ValueType
low complexity region 190 216 N/A INTRINSIC
ANK 354 383 1.29e2 SMART
ANK 390 419 4.93e0 SMART
ANK 423 452 1.63e0 SMART
ANK 462 492 7.89e1 SMART
ANK 523 552 1.17e-1 SMART
ANK 559 592 2.92e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114458
AA Change: L122P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110102
Gene: ENSMUSG00000035356
AA Change: L122P

DomainStartEndE-ValueType
low complexity region 53 83 N/A INTRINSIC
low complexity region 289 315 N/A INTRINSIC
ANK 453 482 1.29e2 SMART
ANK 489 518 4.93e0 SMART
ANK 522 551 1.63e0 SMART
ANK 561 591 7.89e1 SMART
ANK 622 651 1.17e-1 SMART
ANK 658 691 2.92e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231463
Meta Mutation Damage Score 0.8148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to background sensitive prenatal lethality and results in abnormal cytokine secretion, higher IgE levels, ocular surface and perioral skin inflammation accompanied by hair loss, and severe atopic dermatitis-like skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Calb2 C T 8: 110,157,003 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Dmtf1 A G 5: 9,132,454 probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Gab2 A G 7: 97,272,029 T204A probably benign Het
Gapdh T C 6: 125,162,620 N229S possibly damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Iqub G C 6: 24,462,037 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
L1td1 A G 4: 98,737,518 E650G possibly damaging Het
Lilra5 G A 7: 4,238,757 G185D probably damaging Het
Lpin1 A G 12: 16,565,583 S323P possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Myo1h G A 5: 114,328,740 C283Y probably benign Het
Olfr395 T C 11: 73,906,658 Y278C possibly damaging Het
Olfr95 A G 17: 37,211,536 F106L possibly damaging Het
Paqr8 A G 1: 20,935,033 E137G probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pes1 T C 11: 3,975,736 probably benign Het
Reln A T 5: 22,040,420 I730N possibly damaging Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc13a4 C T 6: 35,268,926 V595M probably damaging Het
Smarca2 A G 19: 26,683,822 E939G possibly damaging Het
Spg11 A G 2: 122,083,398 probably null Het
Trpm1 T A 7: 64,199,313 Y102* probably null Het
Usp42 A G 5: 143,717,199 S556P probably benign Het
Zfp957 A G 14: 79,212,892 V489A probably damaging Het
Other mutations in Nfkbiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Nfkbiz APN 16 55817909 missense probably benign
IGL01324:Nfkbiz APN 16 55815804 missense probably damaging 1.00
IGL02086:Nfkbiz APN 16 55815671 missense probably damaging 1.00
IGL02627:Nfkbiz APN 16 55816351 missense probably damaging 1.00
IGL02740:Nfkbiz APN 16 55817954 missense probably benign
R0349:Nfkbiz UTSW 16 55818991 critical splice donor site probably null
R0539:Nfkbiz UTSW 16 55817879 missense probably benign 0.08
R0827:Nfkbiz UTSW 16 55816367 missense probably damaging 1.00
R1403:Nfkbiz UTSW 16 55816470 splice site probably benign
R1743:Nfkbiz UTSW 16 55816394 missense possibly damaging 0.82
R2090:Nfkbiz UTSW 16 55816455 missense probably benign 0.01
R2163:Nfkbiz UTSW 16 55818218 missense probably benign 0.00
R3974:Nfkbiz UTSW 16 55818436 missense probably benign 0.42
R4513:Nfkbiz UTSW 16 55816841 missense probably benign 0.20
R4765:Nfkbiz UTSW 16 55819024 critical splice acceptor site probably null
R4864:Nfkbiz UTSW 16 55818424 missense probably damaging 1.00
R5134:Nfkbiz UTSW 16 55818500 missense probably damaging 1.00
R5265:Nfkbiz UTSW 16 55819641 missense probably damaging 1.00
R5510:Nfkbiz UTSW 16 55814020 missense probably damaging 1.00
R6327:Nfkbiz UTSW 16 55821962 missense probably damaging 1.00
R7083:Nfkbiz UTSW 16 55818300 missense possibly damaging 0.88
R7369:Nfkbiz UTSW 16 55821846 missense probably damaging 1.00
R7650:Nfkbiz UTSW 16 55817839 missense probably benign 0.34
Z1088:Nfkbiz UTSW 16 55816438 missense probably damaging 1.00
Z1088:Nfkbiz UTSW 16 55818236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCGTACTCAGACAGCTATC -3'
(R):5'- GCTGCTTGAGGGCTTTATCC -3'

Sequencing Primer
(F):5'- CTAGGAACTCGGTCACCTATG -3'
(R):5'- CTTGAGGGCTTTATCCACCAGG -3'
Posted On2015-02-18