Incidental Mutation 'R3196:Myo3a'
ID267620
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Namemyosin IIIA
Synonyms9030416P08Rik
MMRRC Submission 040617-MU
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location22227503-22618252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 22399868 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 678 (K678N)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044749
AA Change: K678N

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: K678N

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153002
AA Change: K670N

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: K670N

DomainStartEndE-ValueType
S_TKc 21 287 1.62e-91 SMART
MYSc 332 753 3.06e-35 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ATGTCAAATGCTGCCGTTCC -3'
(R):5'- GATGGCGCTACTAAAAGATAAACTG -3'

Sequencing Primer
(F):5'- AAATGCTGCCGTTCCATTTAG -3'
(R):5'- ATCAGAAACATATTCAAAGGGACTC -3'
Posted On2015-02-18