Incidental Mutation 'R3196:Med27'
ID267621
Institutional Source Beutler Lab
Gene Symbol Med27
Ensembl Gene ENSMUSG00000026799
Gene Namemediator complex subunit 27
SynonymsD2Ertd434e, Crsp8, 1500015J03Rik, 2310042P07Rik
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29346819-29524793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29346870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 9 (V9E)
Ref Sequence ENSEMBL: ENSMUSP00000109461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028139] [ENSMUST00000113830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028139
AA Change: V9E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028139
Gene: ENSMUSG00000026799
AA Change: V9E

DomainStartEndE-ValueType
Pfam:Med27 228 310 7.2e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113830
AA Change: V9E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153600
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Med27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Med27 APN 2 29413482 missense probably damaging 1.00
R0427:Med27 UTSW 2 29500271 missense probably damaging 1.00
R1769:Med27 UTSW 2 29500295 missense probably damaging 0.99
R2126:Med27 UTSW 2 29524430 nonsense probably null
R4093:Med27 UTSW 2 29377908 unclassified probably benign
R4498:Med27 UTSW 2 29471342 missense probably damaging 0.99
R4599:Med27 UTSW 2 29524458 missense probably damaging 1.00
R4722:Med27 UTSW 2 29524435 missense probably damaging 0.98
R4771:Med27 UTSW 2 29413503 missense probably damaging 1.00
R4828:Med27 UTSW 2 29377938 unclassified probably benign
R5870:Med27 UTSW 2 29389811 critical splice acceptor site probably null
R6061:Med27 UTSW 2 29509441 missense probably damaging 0.99
R6159:Med27 UTSW 2 29524364 splice site probably null
R7028:Med27 UTSW 2 29509434 nonsense probably null
R7319:Med27 UTSW 2 29413478 missense possibly damaging 0.53
R7387:Med27 UTSW 2 29413407 missense possibly damaging 0.96
R7671:Med27 UTSW 2 29377938 missense
R8255:Med27 UTSW 2 29524364 splice site probably null
Predicted Primers PCR Primer
(F):5'- GATGGAGATCATAACTTGTGGTCAAC -3'
(R):5'- TACTTGAGGTCCCGGTTGAC -3'

Sequencing Primer
(F):5'- TCATTCAGTCAGACTGGCG -3'
(R):5'- TGACGGAATGCAAGTTGTCC -3'
Posted On2015-02-18