Mutagenetix > Incidental Mutations

Incidental Mutation 'R3196:Slc9b2'

267628

Institutional Source

Beutler Lab

Gene Symbol

Slc9b2

Ensembl Gene

ENSMUSG00000037994

Gene Name

solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2

Synonyms

C80638, nha-oc, Nhedc2, NHE10, NHA2

MMRRC Submission

040617-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135307700-135345387 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 135336529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 523 (R523L)

Ref Sequence

ENSEMBL: ENSMUSP00000060640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051849] [ENSMUST00000145195]

AlphaFold

Q5BKR2

Predicted Effect

probably benign
Transcript: ENSMUST00000051849
AA Change: R523L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000060640
Gene: ENSMUSG00000037994
AA Change: R523L

Domain	Start	End	E-Value	Type
transmembrane domain	83	102	N/A	INTRINSIC
Pfam:Na_H_Exchanger	116	515	4.4e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132405

Predicted Effect

probably benign
Transcript: ENSMUST00000145195

SMART Domains

Protein: ENSMUSP00000123083
Gene: ENSMUSG00000037994

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
transmembrane domain	47	69	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sodium hydrogen antiporters, such as NHEDC2, convert the proton motive force established by the respiratory chain or the F1F0 mitochondrial ATPase into sodium gradients that drive other energy-requiring processes, transduce environmental signals into cell responses, or function in drug efflux (Xiang et al., 2007 [PubMed 18000046]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal, with no detectable abnormalities in osteoclast differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,028,736	N158K	probably benign	Het
Acnat1	G	C	4: 49,447,457	P357A	probably damaging	Het
Aes	A	G	10: 81,565,640	N181D	probably benign	Het
Akap6	T	A	12: 53,072,457	C1102*	probably null	Het
Amelx	T	C	X: 169,181,830		probably benign	Het
Brap	G	A	5: 121,665,196	V136I	possibly damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Csgalnact1	TGG	TG	8: 68,461,085		probably null	Het
Csk	A	T	9: 57,630,273	C119*	probably null	Het
Dcbld1	T	C	10: 52,319,491	L265P	probably damaging	Het
Desi1	T	A	15: 82,003,775	K31N	probably damaging	Het
Dpy19l2	C	A	9: 24,695,989	G59C	probably damaging	Het
Eif2b5	T	C	16: 20,505,522	V498A	probably benign	Het
Epdr1	A	T	13: 19,594,645	Y94N	probably damaging	Het
Fat1	T	C	8: 44,951,868	V552A	probably benign	Het
Focad	A	G	4: 88,407,351	E151G	possibly damaging	Het
Frem1	A	G	4: 83,014,114	F117L	probably damaging	Het
Frem2	A	T	3: 53,537,331	Y2460N	probably damaging	Het
Gm3604	A	T	13: 62,370,054	C163*	probably null	Het
Gpalpp1	A	C	14: 76,098,623		probably null	Het
Grid2ip	A	G	5: 143,388,178	I858V	probably damaging	Het
Grin2b	ATTGTTGT	ATTGT	6: 135,732,455		probably benign	Het
Hps4	A	G	5: 112,364,563	T182A	probably damaging	Het
Impa1	A	T	3: 10,329,015		probably null	Het
Kcnh3	T	C	15: 99,233,981	S606P	probably damaging	Het
Kif23	T	A	9: 61,931,911	R301*	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lcp2	G	T	11: 34,090,670	A529S	probably benign	Het
Lhx8	G	A	3: 154,330,288	A22V	probably benign	Het
Lin28a	A	T	4: 134,007,924	S134T	possibly damaging	Het
Med27	T	A	2: 29,346,870	V9E	possibly damaging	Het
Mmp7	C	A	9: 7,692,218	S31R	probably benign	Het
Mtcl1	T	G	17: 66,343,834	E1545D	probably benign	Het
Muc16	A	G	9: 18,497,830	Y187H	probably damaging	Het
Myo3a	G	T	2: 22,399,868	K678N	possibly damaging	Het
Nsmce1	T	C	7: 125,486,473	M15V	probably benign	Het
Nxpe3	A	T	16: 55,849,715	N342K	probably damaging	Het
Olfr229	T	A	9: 39,910,460	I219N	probably damaging	Het
Olfr843	A	G	9: 19,249,199	S67P	probably damaging	Het
Pcdhb9	A	G	18: 37,401,610	N219S	probably benign	Het
Pck2	T	A	14: 55,543,992	V190E	probably damaging	Het
Pde4b	G	A	4: 102,599,643	A429T	probably damaging	Het
Phf1	T	C	17: 26,934,455	V54A	probably damaging	Het
Pla2r1	T	C	2: 60,522,783	E278G	probably damaging	Het
Ptges3	G	T	10: 128,072,147	R122L	probably benign	Het
Rnpepl1	C	T	1: 92,917,159	T391I	probably damaging	Het
Rps6kb1	G	A	11: 86,506,807	A404V	probably benign	Het
Rrm2b	T	C	15: 37,945,147		probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Skint9	T	G	4: 112,390,951	I199L	probably benign	Het
Slco1c1	T	A	6: 141,531,448		probably null	Het
Stox2	T	C	8: 47,192,830	T532A	probably damaging	Het
Tbcel	A	G	9: 42,415,952	L385P	probably damaging	Het
Tmem268	G	A	4: 63,577,912		probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Top3a	G	A	11: 60,759,356	T122M	probably damaging	Het
Trav7n-4	G	A	14: 53,091,631	V33I	probably benign	Het
Ttn	T	G	2: 76,709,207	E26151D	possibly damaging	Het
Ttn	C	T	2: 76,856,884		probably benign	Het
Tyk2	A	G	9: 21,124,032	C195R	possibly damaging	Het
Ugt2b38	T	C	5: 87,410,219	K528E	probably damaging	Het
Usp28	T	A	9: 49,025,825	D483E	probably benign	Het
Vldlr	A	G	19: 27,243,154	D598G	probably damaging	Het
Vmn1r51	T	G	6: 90,129,516	I138S	probably damaging	Het
Vps13b	G	A	15: 35,869,395	A2682T	probably damaging	Het
Wac	T	A	18: 7,917,568	V346E	probably damaging	Het
Zdbf2	T	C	1: 63,308,420	V1986A	possibly damaging	Het

Other mutations in Slc9b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01626:Slc9b2	APN	3	135336395	missense	probably benign	0.17
IGL03091:Slc9b2	APN	3	135329030	missense	probably damaging	0.97
IGL03203:Slc9b2	APN	3	135326212	missense	probably damaging	1.00
IGL03377:Slc9b2	APN	3	135336358	missense	probably damaging	1.00
IGL02988:Slc9b2	UTSW	3	135318418	missense	probably benign	0.02
R0008:Slc9b2	UTSW	3	135336508	missense	possibly damaging	0.72
R0382:Slc9b2	UTSW	3	135318422	missense	probably damaging	0.99
R0628:Slc9b2	UTSW	3	135323775	splice site	probably benign
R1263:Slc9b2	UTSW	3	135336395	missense	probably benign	0.17
R1478:Slc9b2	UTSW	3	135326102	missense	probably benign	0.45
R1809:Slc9b2	UTSW	3	135317131	missense	possibly damaging	0.90
R2060:Slc9b2	UTSW	3	135326266	missense	probably damaging	0.99
R2119:Slc9b2	UTSW	3	135328982	splice site	probably null
R3805:Slc9b2	UTSW	3	135324588	missense	probably damaging	1.00
R4127:Slc9b2	UTSW	3	135329837	missense	probably benign	0.00
R4401:Slc9b2	UTSW	3	135336544	missense	probably benign	0.04
R4402:Slc9b2	UTSW	3	135336544	missense	probably benign	0.04
R4622:Slc9b2	UTSW	3	135332518	missense	probably damaging	1.00
R6125:Slc9b2	UTSW	3	135330696	splice site	probably null
R7081:Slc9b2	UTSW	3	135321937	missense	probably benign	0.10
R7166:Slc9b2	UTSW	3	135326178	missense	unknown
R7203:Slc9b2	UTSW	3	135330661	missense	probably benign	0.04
R7307:Slc9b2	UTSW	3	135318390	missense	probably benign	0.03
R7617:Slc9b2	UTSW	3	135336460	missense	probably damaging	1.00
R7722:Slc9b2	UTSW	3	135329835	missense	probably null	0.20
R7748:Slc9b2	UTSW	3	135326179	missense	possibly damaging	0.90
R7750:Slc9b2	UTSW	3	135326237	missense	probably damaging	1.00
R8339:Slc9b2	UTSW	3	135324602	missense	possibly damaging	0.62
R8703:Slc9b2	UTSW	3	135326163	nonsense	probably null
R8711:Slc9b2	UTSW	3	135324590	missense	probably benign	0.05
R8810:Slc9b2	UTSW	3	135329769	missense	probably benign	0.00
R9079:Slc9b2	UTSW	3	135336389	missense	probably damaging	1.00
R9229:Slc9b2	UTSW	3	135336534	missense	probably benign
R9369:Slc9b2	UTSW	3	135330685	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- TAACACTTTCGTAGGCTGCCATTG -3'
(R):5'- AGCAGATGAGGCTATGGACC -3'

Sequencing Primer
(F):5'- GCCATTGGCTCTGTGGCTC -3'
(R):5'- CAGATGAGGCTATGGACCTTGGTC -3'

Posted On

2015-02-18