Incidental Mutation 'R3196:Tmem268'
ID267631
Institutional Source Beutler Lab
Gene Symbol Tmem268
Ensembl Gene ENSMUSG00000045917
Gene Nametransmembrane protein 268
Synonyms6330416G13Rik
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location63558781-63586357 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 63577912 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000079211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077709] [ENSMUST00000080336]
Predicted Effect probably null
Transcript: ENSMUST00000077709
SMART Domains Protein: ENSMUSP00000076891
Gene: ENSMUSG00000045917

DomainStartEndE-ValueType
Pfam:DUF4481 39 328 4.2e-130 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000080336
SMART Domains Protein: ENSMUSP00000079211
Gene: ENSMUSG00000045917

DomainStartEndE-ValueType
Pfam:DUF4481 38 328 4.4e-127 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Tmem268
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Tmem268 APN 4 63568454 splice site probably benign
R0140:Tmem268 UTSW 4 63577859 missense possibly damaging 0.94
R1473:Tmem268 UTSW 4 63580338 missense probably damaging 0.99
R1816:Tmem268 UTSW 4 63565710 missense possibly damaging 0.75
R1845:Tmem268 UTSW 4 63579943 missense probably damaging 1.00
R4296:Tmem268 UTSW 4 63565768 critical splice donor site probably null
R4927:Tmem268 UTSW 4 63583927 missense probably benign
R5023:Tmem268 UTSW 4 63568540 missense probably damaging 1.00
R5057:Tmem268 UTSW 4 63568540 missense probably damaging 1.00
R5946:Tmem268 UTSW 4 63568509 missense probably damaging 1.00
R7138:Tmem268 UTSW 4 63562450 start gained probably benign
R7577:Tmem268 UTSW 4 63562444 start gained probably benign
R8188:Tmem268 UTSW 4 63579972 missense probably damaging 0.97
R8428:Tmem268 UTSW 4 63577904 missense probably damaging 1.00
R8675:Tmem268 UTSW 4 63583871 missense probably damaging 1.00
R8773:Tmem268 UTSW 4 63580293 missense probably benign 0.02
R8777:Tmem268 UTSW 4 63577839 missense probably damaging 1.00
R8777-TAIL:Tmem268 UTSW 4 63577839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTGAAGGTTGACTTGC -3'
(R):5'- AGTGCCCAACCTCAGGATAC -3'

Sequencing Primer
(F):5'- AAGGTTGACTTGCGGCCTC -3'
(R):5'- CCTCAGGATACAGCGCAGAG -3'
Posted On2015-02-18