Incidental Mutation 'R3196:Focad'
ID267633
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88407351 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 151 (E151G)
Ref Sequence ENSEMBL: ENSMUSP00000102765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000107147] [ENSMUST00000132493] [ENSMUST00000159342]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097992
AA Change: E1745G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: E1745G

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107147
AA Change: E151G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102765
Gene: ENSMUSG00000038368
AA Change: E151G

DomainStartEndE-ValueType
Pfam:DUF3028 1 204 8.6e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107148
Predicted Effect probably benign
Transcript: ENSMUST00000132493
SMART Domains Protein: ENSMUSP00000119411
Gene: ENSMUSG00000028497

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 80 234 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151280
SMART Domains Protein: ENSMUSP00000122565
Gene: ENSMUSG00000028497

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:PTPLA 85 244 3e-37 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159342
AA Change: E1659G
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: E1659G

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162039
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
Microscope UTSW 4 88342204 missense unknown
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
R7427:Focad UTSW 4 88368751 missense unknown
R7582:Focad UTSW 4 88229378 missense probably benign 0.00
R7661:Focad UTSW 4 88303535 missense unknown
R7688:Focad UTSW 4 88178133 missense probably damaging 1.00
R7789:Focad UTSW 4 88229406 missense unknown
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCTTGATGCTGATATTTGCAGC -3'
(R):5'- GCCTCTATCAGATGGCATGTG -3'

Sequencing Primer
(F):5'- CAGCTGCAGTGGTGGCATG -3'
(R):5'- CAGATGGCATGTGAGTGTGAAATTG -3'
Posted On2015-02-18