Incidental Mutation 'R3196:Lin28a'
ID267636
Institutional Source Beutler Lab
Gene Symbol Lin28a
Ensembl Gene ENSMUSG00000050966
Gene Namelin-28 homolog A (C. elegans)
SynonymsLin-28, Tex17, Lin28a, Lin28
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134003330-134018841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134007924 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 134 (S134T)
Ref Sequence ENSEMBL: ENSMUSP00000050488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051674] [ENSMUST00000176113] [ENSMUST00000176292] [ENSMUST00000176897]
PDB Structure Mouse Lin28A in complex with let-7d microRNA pre-element [X-RAY DIFFRACTION]
Mouse Lin28A in complex with let-7f-1 microRNA pre-element [X-RAY DIFFRACTION]
Mouse Lin28A in complex with let-7g microRNA pre-element [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051674
AA Change: S134T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050488
Gene: ENSMUSG00000050966
AA Change: S134T

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
CSP 41 112 5.63e-14 SMART
ZnF_C2HC 138 154 1.91e-2 SMART
ZnF_C2HC 160 176 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176113
AA Change: S54T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000135254
Gene: ENSMUSG00000050966
AA Change: S54T

DomainStartEndE-ValueType
Pfam:CSD 1 32 1.9e-7 PFAM
ZnF_C2HC 58 74 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176292
AA Change: S54T

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135608
Gene: ENSMUSG00000050966
AA Change: S54T

DomainStartEndE-ValueType
Pfam:CSD 1 32 1.8e-7 PFAM
ZnF_C2HC 58 74 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176897
SMART Domains Protein: ENSMUSP00000135736
Gene: ENSMUSG00000050966

DomainStartEndE-ValueType
Pfam:CSD 1 62 5.8e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LIN-28 family RNA-binding protein that acts as a posttranscriptional regulator of genes involved in developmental timing and self-renewal in embryonic stem cells. The encoded protein functions through direct interaction with target mRNAs and by disrupting the maturation of certain miRNAs involved in embryonic development. This protein prevents the terminal processing of the LET7 family of microRNAs which are major regulators of cellular growth and differentiation. Aberrant expression of this gene is associated with cancer progression in multiple tissues. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased birth weight and postnatal lethality. In another report, mice homozygous for the same or an identical allele exhibit reduced premordial germ cells and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Lin28a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Lin28a APN 4 134008056 missense probably damaging 1.00
IGL01515:Lin28a APN 4 134018709 critical splice donor site probably null
IGL01725:Lin28a APN 4 134007930 nonsense probably null
R0659:Lin28a UTSW 4 134008099 splice site probably benign
R0730:Lin28a UTSW 4 134008008 missense probably damaging 1.00
R2129:Lin28a UTSW 4 134018154 missense probably benign 0.00
R4998:Lin28a UTSW 4 134018717 missense possibly damaging 0.73
R5734:Lin28a UTSW 4 134007973 nonsense probably null
R6540:Lin28a UTSW 4 134018061 missense possibly damaging 0.85
R7012:Lin28a UTSW 4 134018729 missense probably damaging 1.00
R7226:Lin28a UTSW 4 134006308 missense probably damaging 1.00
R7972:Lin28a UTSW 4 134006263 missense probably damaging 0.96
R8072:Lin28a UTSW 4 134018142 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTCCGGTCAAGAACTGTAGATAC -3'
(R):5'- AGCTGCACATGGAAGGGTTC -3'

Sequencing Primer
(F):5'- ACAGATCCACATTCTAACCTTTCC -3'
(R):5'- GTTCCGAAGCCTCAAGGAG -3'
Posted On2015-02-18