Mutagenetix > Incidental Mutations

Incidental Mutation 'R3196:Muc16'

267650

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

040617-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R3196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 18497830 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 187 (Y187H)

Ref Sequence

ENSEMBL: ENSMUSP00000034653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034653] [ENSMUST00000208663]

PDB Structure

Solution structure of the SEA domain from murine hypothetical protein homologous to human mucin 16 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034653
AA Change: Y187H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034653
Gene: ENSMUSG00000109564
AA Change: Y187H

Domain	Start	End	E-Value	Type
Pfam:SEA	71	174	9.6e-30	PFAM
transmembrane domain	205	227	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000207857
AA Change: Y2494H

Predicted Effect

probably damaging
Transcript: ENSMUST00000208663
AA Change: Y8407H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,028,736	N158K	probably benign	Het
Acnat1	G	C	4: 49,447,457	P357A	probably damaging	Het
Aes	A	G	10: 81,565,640	N181D	probably benign	Het
Akap6	T	A	12: 53,072,457	C1102*	probably null	Het
Amelx	T	C	X: 169,181,830		probably benign	Het
Brap	G	A	5: 121,665,196	V136I	possibly damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Csgalnact1	TGG	TG	8: 68,461,085		probably null	Het
Csk	A	T	9: 57,630,273	C119*	probably null	Het
Dcbld1	T	C	10: 52,319,491	L265P	probably damaging	Het
Desi1	T	A	15: 82,003,775	K31N	probably damaging	Het
Dpy19l2	C	A	9: 24,695,989	G59C	probably damaging	Het
Eif2b5	T	C	16: 20,505,522	V498A	probably benign	Het
Epdr1	A	T	13: 19,594,645	Y94N	probably damaging	Het
Fat1	T	C	8: 44,951,868	V552A	probably benign	Het
Focad	A	G	4: 88,407,351	E151G	possibly damaging	Het
Frem1	A	G	4: 83,014,114	F117L	probably damaging	Het
Frem2	A	T	3: 53,537,331	Y2460N	probably damaging	Het
Gm3604	A	T	13: 62,370,054	C163*	probably null	Het
Gpalpp1	A	C	14: 76,098,623		probably null	Het
Grid2ip	A	G	5: 143,388,178	I858V	probably damaging	Het
Grin2b	ATTGTTGT	ATTGT	6: 135,732,455		probably benign	Het
Hps4	A	G	5: 112,364,563	T182A	probably damaging	Het
Impa1	A	T	3: 10,329,015		probably null	Het
Kcnh3	T	C	15: 99,233,981	S606P	probably damaging	Het
Kif23	T	A	9: 61,931,911	R301*	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lcp2	G	T	11: 34,090,670	A529S	probably benign	Het
Lhx8	G	A	3: 154,330,288	A22V	probably benign	Het
Lin28a	A	T	4: 134,007,924	S134T	possibly damaging	Het
Med27	T	A	2: 29,346,870	V9E	possibly damaging	Het
Mmp7	C	A	9: 7,692,218	S31R	probably benign	Het
Mtcl1	T	G	17: 66,343,834	E1545D	probably benign	Het
Myo3a	G	T	2: 22,399,868	K678N	possibly damaging	Het
Nsmce1	T	C	7: 125,486,473	M15V	probably benign	Het
Nxpe3	A	T	16: 55,849,715	N342K	probably damaging	Het
Olfr229	T	A	9: 39,910,460	I219N	probably damaging	Het
Olfr843	A	G	9: 19,249,199	S67P	probably damaging	Het
Pcdhb9	A	G	18: 37,401,610	N219S	probably benign	Het
Pck2	T	A	14: 55,543,992	V190E	probably damaging	Het
Pde4b	G	A	4: 102,599,643	A429T	probably damaging	Het
Phf1	T	C	17: 26,934,455	V54A	probably damaging	Het
Pla2r1	T	C	2: 60,522,783	E278G	probably damaging	Het
Ptges3	G	T	10: 128,072,147	R122L	probably benign	Het
Rnpepl1	C	T	1: 92,917,159	T391I	probably damaging	Het
Rps6kb1	G	A	11: 86,506,807	A404V	probably benign	Het
Rrm2b	T	C	15: 37,945,147		probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Skint9	T	G	4: 112,390,951	I199L	probably benign	Het
Slc9b2	G	T	3: 135,336,529	R523L	probably benign	Het
Slco1c1	T	A	6: 141,531,448		probably null	Het
Stox2	T	C	8: 47,192,830	T532A	probably damaging	Het
Tbcel	A	G	9: 42,415,952	L385P	probably damaging	Het
Tmem268	G	A	4: 63,577,912		probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Top3a	G	A	11: 60,759,356	T122M	probably damaging	Het
Trav7n-4	G	A	14: 53,091,631	V33I	probably benign	Het
Ttn	T	G	2: 76,709,207	E26151D	possibly damaging	Het
Ttn	C	T	2: 76,856,884		probably benign	Het
Tyk2	A	G	9: 21,124,032	C195R	possibly damaging	Het
Ugt2b38	T	C	5: 87,410,219	K528E	probably damaging	Het
Usp28	T	A	9: 49,025,825	D483E	probably benign	Het
Vldlr	A	G	19: 27,243,154	D598G	probably damaging	Het
Vmn1r51	T	G	6: 90,129,516	I138S	probably damaging	Het
Vps13b	G	A	15: 35,869,395	A2682T	probably damaging	Het
Wac	T	A	18: 7,917,568	V346E	probably damaging	Het
Zdbf2	T	C	1: 63,308,420	V1986A	possibly damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGCACTCCTCCTCAACAG -3'
(R):5'- ACCTTGGATTTTACACTGAGCTTC -3'

Sequencing Primer
(F):5'- AACAGTCTTTGCCATAGTTTGACC -3'
(R):5'- ACTGGCCAGGCATGATGG -3'

Posted On

2015-02-18