Mutagenetix > Incidental Mutations

Incidental Mutation 'R3196:Dpy19l2'

267653

Institutional Source

Beutler Lab

Gene Symbol

Dpy19l2

Ensembl Gene

ENSMUSG00000085576

Gene Name

dpy-19-like 2 (C. elegans)

Synonyms

MMRRC Submission

040617-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R3196 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24557047-24696293 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 24695989 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 59 (G59C)

Ref Sequence

ENSEMBL: ENSMUSP00000132092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000133010]

Predicted Effect

probably damaging
Transcript: ENSMUST00000133010
AA Change: G59C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132092
Gene: ENSMUSG00000085576
AA Change: G59C

Domain	Start	End	E-Value	Type
Pfam:Dpy19	129	772	3.1e-233	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dpy-19 family. It is highly expressed in testis, and is required for sperm head elongation and acrosome formation during spermatogenesis. Mutations in this gene are associated with an infertility disorder, spermatogenic failure type 9 (SPGF9). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility associated with globozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,028,736	N158K	probably benign	Het
Acnat1	G	C	4: 49,447,457	P357A	probably damaging	Het
Aes	A	G	10: 81,565,640	N181D	probably benign	Het
Akap6	T	A	12: 53,072,457	C1102*	probably null	Het
Amelx	T	C	X: 169,181,830		probably benign	Het
Brap	G	A	5: 121,665,196	V136I	possibly damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Csgalnact1	TGG	TG	8: 68,461,085		probably null	Het
Csk	A	T	9: 57,630,273	C119*	probably null	Het
Dcbld1	T	C	10: 52,319,491	L265P	probably damaging	Het
Desi1	T	A	15: 82,003,775	K31N	probably damaging	Het
Eif2b5	T	C	16: 20,505,522	V498A	probably benign	Het
Epdr1	A	T	13: 19,594,645	Y94N	probably damaging	Het
Fat1	T	C	8: 44,951,868	V552A	probably benign	Het
Focad	A	G	4: 88,407,351	E151G	possibly damaging	Het
Frem1	A	G	4: 83,014,114	F117L	probably damaging	Het
Frem2	A	T	3: 53,537,331	Y2460N	probably damaging	Het
Gm3604	A	T	13: 62,370,054	C163*	probably null	Het
Gpalpp1	A	C	14: 76,098,623		probably null	Het
Grid2ip	A	G	5: 143,388,178	I858V	probably damaging	Het
Grin2b	ATTGTTGT	ATTGT	6: 135,732,455		probably benign	Het
Hps4	A	G	5: 112,364,563	T182A	probably damaging	Het
Impa1	A	T	3: 10,329,015		probably null	Het
Kcnh3	T	C	15: 99,233,981	S606P	probably damaging	Het
Kif23	T	A	9: 61,931,911	R301*	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lcp2	G	T	11: 34,090,670	A529S	probably benign	Het
Lhx8	G	A	3: 154,330,288	A22V	probably benign	Het
Lin28a	A	T	4: 134,007,924	S134T	possibly damaging	Het
Med27	T	A	2: 29,346,870	V9E	possibly damaging	Het
Mmp7	C	A	9: 7,692,218	S31R	probably benign	Het
Mtcl1	T	G	17: 66,343,834	E1545D	probably benign	Het
Muc16	A	G	9: 18,497,830	Y187H	probably damaging	Het
Myo3a	G	T	2: 22,399,868	K678N	possibly damaging	Het
Nsmce1	T	C	7: 125,486,473	M15V	probably benign	Het
Nxpe3	A	T	16: 55,849,715	N342K	probably damaging	Het
Olfr229	T	A	9: 39,910,460	I219N	probably damaging	Het
Olfr843	A	G	9: 19,249,199	S67P	probably damaging	Het
Pcdhb9	A	G	18: 37,401,610	N219S	probably benign	Het
Pck2	T	A	14: 55,543,992	V190E	probably damaging	Het
Pde4b	G	A	4: 102,599,643	A429T	probably damaging	Het
Phf1	T	C	17: 26,934,455	V54A	probably damaging	Het
Pla2r1	T	C	2: 60,522,783	E278G	probably damaging	Het
Ptges3	G	T	10: 128,072,147	R122L	probably benign	Het
Rnpepl1	C	T	1: 92,917,159	T391I	probably damaging	Het
Rps6kb1	G	A	11: 86,506,807	A404V	probably benign	Het
Rrm2b	T	C	15: 37,945,147		probably null	Het
Sh3rf1	C	T	8: 61,226,287	P121L	probably benign	Het
Skint9	T	G	4: 112,390,951	I199L	probably benign	Het
Slc9b2	G	T	3: 135,336,529	R523L	probably benign	Het
Slco1c1	T	A	6: 141,531,448		probably null	Het
Stox2	T	C	8: 47,192,830	T532A	probably damaging	Het
Tbcel	A	G	9: 42,415,952	L385P	probably damaging	Het
Tmem268	G	A	4: 63,577,912		probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Top3a	G	A	11: 60,759,356	T122M	probably damaging	Het
Trav7n-4	G	A	14: 53,091,631	V33I	probably benign	Het
Ttn	T	G	2: 76,709,207	E26151D	possibly damaging	Het
Ttn	C	T	2: 76,856,884		probably benign	Het
Tyk2	A	G	9: 21,124,032	C195R	possibly damaging	Het
Ugt2b38	T	C	5: 87,410,219	K528E	probably damaging	Het
Usp28	T	A	9: 49,025,825	D483E	probably benign	Het
Vldlr	A	G	19: 27,243,154	D598G	probably damaging	Het
Vmn1r51	T	G	6: 90,129,516	I138S	probably damaging	Het
Vps13b	G	A	15: 35,869,395	A2682T	probably damaging	Het
Wac	T	A	18: 7,917,568	V346E	probably damaging	Het
Zdbf2	T	C	1: 63,308,420	V1986A	possibly damaging	Het

Other mutations in Dpy19l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Dpy19l2	APN	9	24582818	missense	probably damaging	1.00
IGL01137:Dpy19l2	APN	9	24658562	missense	possibly damaging	0.78
IGL01586:Dpy19l2	APN	9	24666975	missense	probably benign	0.16
IGL02245:Dpy19l2	APN	9	24696025	missense	probably benign
IGL02507:Dpy19l2	APN	9	24631267	missense	probably benign	0.01
IGL02541:Dpy19l2	APN	9	24658647	missense	probably benign	0.00
IGL02644:Dpy19l2	APN	9	24658592	missense	probably damaging	1.00
IGL03144:Dpy19l2	APN	9	24646307	missense	possibly damaging	0.92
Deferential	UTSW	9	24695814	missense	probably benign	0.41
polite	UTSW	9	24660743	missense	possibly damaging	0.91
R0022:Dpy19l2	UTSW	9	24696124	missense	probably benign
R0029:Dpy19l2	UTSW	9	24558101	missense	probably damaging	0.97
R0066:Dpy19l2	UTSW	9	24646383	splice site	probably benign
R0066:Dpy19l2	UTSW	9	24646383	splice site	probably benign
R0089:Dpy19l2	UTSW	9	24695793	missense	probably benign	0.01
R0240:Dpy19l2	UTSW	9	24658580	missense	probably damaging	1.00
R0240:Dpy19l2	UTSW	9	24658580	missense	probably damaging	1.00
R0349:Dpy19l2	UTSW	9	24695922	missense	possibly damaging	0.89
R0491:Dpy19l2	UTSW	9	24696028	missense	probably benign	0.09
R0519:Dpy19l2	UTSW	9	24558095	missense	probably benign	0.30
R1398:Dpy19l2	UTSW	9	24581263	splice site	probably benign
R1465:Dpy19l2	UTSW	9	24669322	missense	probably benign	0.04
R1465:Dpy19l2	UTSW	9	24669322	missense	probably benign	0.04
R1576:Dpy19l2	UTSW	9	24584502	missense	probably benign
R1606:Dpy19l2	UTSW	9	24581215	missense	probably benign
R2157:Dpy19l2	UTSW	9	24584632	missense	probably benign	0.00
R2157:Dpy19l2	UTSW	9	24680780	missense	probably benign	0.02
R2402:Dpy19l2	UTSW	9	24581248	missense	probably damaging	1.00
R2409:Dpy19l2	UTSW	9	24658628	missense	probably benign	0.00
R3419:Dpy19l2	UTSW	9	24581205	missense	probably damaging	1.00
R4884:Dpy19l2	UTSW	9	24628180	nonsense	probably null
R5289:Dpy19l2	UTSW	9	24695997	missense	probably benign
R5950:Dpy19l2	UTSW	9	24581134	missense	probably benign	0.10
R6470:Dpy19l2	UTSW	9	24660743	missense	possibly damaging	0.91
R7028:Dpy19l2	UTSW	9	24628251	missense	probably benign	0.15
R7051:Dpy19l2	UTSW	9	24584493	missense	probably benign	0.00
R7095:Dpy19l2	UTSW	9	24695814	missense	probably benign	0.41
R7649:Dpy19l2	UTSW	9	24696163	start codon destroyed	probably null	0.53
X0067:Dpy19l2	UTSW	9	24585537	missense	probably benign	0.00
Z1088:Dpy19l2	UTSW	9	24660824	splice site	probably null
Z1177:Dpy19l2	UTSW	9	24646359	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TGGAACACTGAGCAGACTCG -3'
(R):5'- CTGATCACGGGCTATGAGAAGATG -3'

Sequencing Primer
(F):5'- CTGTGGGAGAACCGATGCATC -3'
(R):5'- CTATGAGAAGATGGTGGGGCC -3'

Posted On

2015-02-18