Incidental Mutation 'R3196:Olfr229'
ID267654
Institutional Source Beutler Lab
Gene Symbol Olfr229
Ensembl Gene ENSMUSG00000095390
Gene Nameolfactory receptor 229
SynonymsGA_x6K02T02EEW-227-373, MOR171-14, Olfr973, GA_x6K02T2PVTD-33608180-33608971
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39907336-39912732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39910460 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 219 (I219N)
Ref Sequence ENSEMBL: ENSMUSP00000149063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076802] [ENSMUST00000214904]
Predicted Effect probably damaging
Transcript: ENSMUST00000076802
AA Change: I219N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076080
Gene: ENSMUSG00000095390
AA Change: I219N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.7e-51 PFAM
Pfam:7tm_1 41 290 7.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214904
AA Change: I219N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Olfr229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Olfr229 APN 9 39910606 missense possibly damaging 0.94
IGL01880:Olfr229 APN 9 39909941 missense possibly damaging 0.95
IGL02142:Olfr229 APN 9 39910639 missense possibly damaging 0.75
IGL02366:Olfr229 APN 9 39909992 missense probably damaging 1.00
R0415:Olfr229 UTSW 9 39909983 missense probably damaging 1.00
R1383:Olfr229 UTSW 9 39909864 missense probably benign 0.10
R1838:Olfr229 UTSW 9 39909841 missense possibly damaging 0.90
R3951:Olfr229 UTSW 9 39910725 missense probably benign 0.40
R4984:Olfr229 UTSW 9 39910610 missense probably benign 0.14
R5771:Olfr229 UTSW 9 39910250 missense probably damaging 1.00
R7454:Olfr229 UTSW 9 39909904 missense probably benign 0.02
R7756:Olfr229 UTSW 9 39910325 missense possibly damaging 0.95
R7758:Olfr229 UTSW 9 39910325 missense possibly damaging 0.95
R7868:Olfr229 UTSW 9 39909986 missense probably benign
R7951:Olfr229 UTSW 9 39909986 missense probably benign
RF021:Olfr229 UTSW 9 39910045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATCATCAGTTCACACAGGC -3'
(R):5'- AATGGGTTCAGCATGGGAAC -3'

Sequencing Primer
(F):5'- CATCAGTTCACACAGGCTTTATG -3'
(R):5'- AGTATAAAACACAGAGGACACTTTC -3'
Posted On2015-02-18