Incidental Mutation 'R3196:Lcp2'
ID267662
Institutional Source Beutler Lab
Gene Symbol Lcp2
Ensembl Gene ENSMUSG00000002699
Gene Namelymphocyte cytosolic protein 2
Synonymstwm, SLP76, SLP-76
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3196 (G1)
Quality Score202
Status Not validated
Chromosome11
Chromosomal Location34046920-34092295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34090670 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 529 (A529S)
Ref Sequence ENSEMBL: ENSMUSP00000056621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052413] [ENSMUST00000109329] [ENSMUST00000223852] [ENSMUST00000224226]
Predicted Effect probably benign
Transcript: ENSMUST00000052413
AA Change: A529S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000056621
Gene: ENSMUSG00000002699
AA Change: A529S

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.93e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 512 4.44e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109329
SMART Domains Protein: ENSMUSP00000104952
Gene: ENSMUSG00000002699

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.86e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 400 412 N/A INTRINSIC
SH2 421 508 8.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146318
Predicted Effect probably benign
Transcript: ENSMUST00000169878
AA Change: A529S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126796
Gene: ENSMUSG00000002699
AA Change: A529S

DomainStartEndE-ValueType
SAM 12 78 9.3e-4 SMART
low complexity region 109 127 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
internal_repeat_1 274 321 1.87e-5 PROSPERO
low complexity region 328 339 N/A INTRINSIC
low complexity region 399 411 N/A INTRINSIC
SH2 420 511 4.44e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223852
Predicted Effect probably benign
Transcript: ENSMUST00000224226
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]
PHENOTYPE: T cell development is blocked and T cell receptor signaling impaired in homozygous point mutants. Double positive thymocyte and single positive T cell numbers are much reduced. Both positive and negative thymocyte selection is abnormal. Mice have high IgG and IgE levels and exhibit autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Lcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Lcp2 APN 11 34047345 start gained probably benign
IGL01730:Lcp2 APN 11 34050943 missense possibly damaging 0.91
IGL02174:Lcp2 APN 11 34050966 splice site probably benign
IGL02228:Lcp2 APN 11 34047424 missense probably damaging 1.00
IGL02814:Lcp2 APN 11 34071033 missense probably damaging 1.00
R0142:Lcp2 UTSW 11 34082418 missense probably damaging 0.97
R0277:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0281:Lcp2 UTSW 11 34069854 splice site probably benign
R0323:Lcp2 UTSW 11 34054322 missense probably damaging 1.00
R0437:Lcp2 UTSW 11 34087229 missense probably benign 0.00
R0632:Lcp2 UTSW 11 34082426 missense possibly damaging 0.87
R1479:Lcp2 UTSW 11 34075068 missense probably benign 0.01
R1570:Lcp2 UTSW 11 34089601 missense probably benign 0.07
R1744:Lcp2 UTSW 11 34069911 splice site probably null
R2212:Lcp2 UTSW 11 34070995 missense probably benign 0.14
R2910:Lcp2 UTSW 11 34068970 splice site probably null
R2911:Lcp2 UTSW 11 34068970 splice site probably null
R4012:Lcp2 UTSW 11 34068439 missense probably damaging 1.00
R4411:Lcp2 UTSW 11 34087173 unclassified probably benign
R4417:Lcp2 UTSW 11 34050917 missense probably benign 0.27
R4423:Lcp2 UTSW 11 34078226 intron probably benign
R4718:Lcp2 UTSW 11 34070992 missense probably benign 0.09
R5090:Lcp2 UTSW 11 34089725 nonsense probably null
R6347:Lcp2 UTSW 11 34082501 missense probably benign 0.10
R7315:Lcp2 UTSW 11 34069906 critical splice donor site probably null
R7694:Lcp2 UTSW 11 34050924 missense probably benign 0.16
R7910:Lcp2 UTSW 11 34088061 missense probably damaging 1.00
R8325:Lcp2 UTSW 11 34082394 missense probably benign 0.34
R8435:Lcp2 UTSW 11 34054316 missense probably damaging 1.00
R8709:Lcp2 UTSW 11 34054354 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GAGGAGGAAATCTCTAAACTACCTG -3'
(R):5'- TCTGCCATGCACTCTTAGAC -3'

Sequencing Primer
(F):5'- ACCTGATAAATGCGTACTGTCC -3'
(R):5'- GCCATGCACTCTTAGACTTCAAATG -3'
Posted On2015-02-18