Incidental Mutation 'R3196:Top3a'
ID267663
Institutional Source Beutler Lab
Gene Symbol Top3a
Ensembl Gene ENSMUSG00000002814
Gene Nametopoisomerase (DNA) III alpha
SynonymsTop IIIa
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3196 (G1)
Quality Score217
Status Not validated
Chromosome11
Chromosomal Location60740058-60777365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60759356 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 122 (T122M)
Ref Sequence ENSEMBL: ENSMUSP00000113653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417] [ENSMUST00000130068]
Predicted Effect probably damaging
Transcript: ENSMUST00000002891
AA Change: T147M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814
AA Change: T147M

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102668
AA Change: T147M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814
AA Change: T147M

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117743
AA Change: T122M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814
AA Change: T122M

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120417
AA Change: T122M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814
AA Change: T122M

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130068
SMART Domains Protein: ENSMUSP00000115727
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
PDB:4CGY|A 1 85 2e-48 PDB
SCOP:d1gkub3 5 85 7e-12 SMART
Blast:TOPRIM 10 85 7e-50 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus reducing the number of supercoils and altering the topology of DNA. This enzyme forms a complex with BLM which functions in the regulation of recombination in somatic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele die shortly after implantation and the induction of decidual reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Top3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Top3a APN 11 60761736 missense probably damaging 1.00
IGL02935:Top3a APN 11 60762528 missense possibly damaging 0.53
R0057:Top3a UTSW 11 60740684 missense probably benign
R0057:Top3a UTSW 11 60740684 missense probably benign
R0369:Top3a UTSW 11 60742789 missense probably damaging 1.00
R1171:Top3a UTSW 11 60750593 missense probably benign 0.02
R1459:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1621:Top3a UTSW 11 60750607 missense probably damaging 1.00
R1812:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1839:Top3a UTSW 11 60753888 missense probably damaging 1.00
R1873:Top3a UTSW 11 60747984 nonsense probably null
R2004:Top3a UTSW 11 60742489 missense probably damaging 0.99
R2277:Top3a UTSW 11 60745874 missense possibly damaging 0.95
R2406:Top3a UTSW 11 60756012 missense probably damaging 1.00
R2418:Top3a UTSW 11 60748016 missense possibly damaging 0.95
R3879:Top3a UTSW 11 60743939 missense possibly damaging 0.92
R4695:Top3a UTSW 11 60742412 missense probably benign 0.40
R4715:Top3a UTSW 11 60742997 nonsense probably null
R4768:Top3a UTSW 11 60762490 missense probably damaging 1.00
R4910:Top3a UTSW 11 60752378 splice site probably benign
R5305:Top3a UTSW 11 60762539 missense possibly damaging 0.56
R5387:Top3a UTSW 11 60762490 missense probably damaging 1.00
R5419:Top3a UTSW 11 60762522 missense probably damaging 1.00
R5806:Top3a UTSW 11 60776920 critical splice donor site probably null
R6162:Top3a UTSW 11 60745937 missense probably damaging 1.00
R6279:Top3a UTSW 11 60749408 missense probably benign 0.02
R6300:Top3a UTSW 11 60749408 missense probably benign 0.02
R6381:Top3a UTSW 11 60744023 missense probably damaging 1.00
R6383:Top3a UTSW 11 60749459 missense probably benign 0.30
R6767:Top3a UTSW 11 60750753 missense possibly damaging 0.84
R6919:Top3a UTSW 11 60749493 missense probably damaging 1.00
R7299:Top3a UTSW 11 60748148 missense probably damaging 0.99
R7301:Top3a UTSW 11 60748148 missense probably damaging 0.99
R7442:Top3a UTSW 11 60753918 missense possibly damaging 0.66
R7690:Top3a UTSW 11 60756380 missense probably damaging 1.00
R7786:Top3a UTSW 11 60776966 missense probably damaging 1.00
R7792:Top3a UTSW 11 60742964 missense probably benign
R8790:Top3a UTSW 11 60740537 missense possibly damaging 0.87
R8818:Top3a UTSW 11 60743051 missense probably damaging 1.00
X0063:Top3a UTSW 11 60750644 nonsense probably null
X0065:Top3a UTSW 11 60763398 missense probably damaging 1.00
Z1176:Top3a UTSW 11 60742637 missense probably benign 0.32
Z1177:Top3a UTSW 11 60742816 missense possibly damaging 0.56
Z1186:Top3a UTSW 11 60750584 missense probably benign
Z1187:Top3a UTSW 11 60750584 missense probably benign
Z1188:Top3a UTSW 11 60750584 missense probably benign
Z1189:Top3a UTSW 11 60750584 missense probably benign
Z1190:Top3a UTSW 11 60750584 missense probably benign
Z1191:Top3a UTSW 11 60750584 missense probably benign
Z1192:Top3a UTSW 11 60750584 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGTCTGCCTGCATGCCAC -3'
(R):5'- CTGATGGACGCTTTTGCCG -3'

Sequencing Primer
(F):5'- GCATGCCACCACGCACATG -3'
(R):5'- AGTTTCCCTAATGCTGAGATCGCAG -3'
Posted On2015-02-18