Incidental Mutation 'R3196:Rps6kb1'
ID267664
Institutional Source Beutler Lab
Gene Symbol Rps6kb1
Ensembl Gene ENSMUSG00000020516
Gene Nameribosomal protein S6 kinase, polypeptide 1
Synonymsp70s6k, 2610318I15Rik, S6K1, p70/85s6k
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86498871-86544805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86506807 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 404 (A404V)
Ref Sequence ENSEMBL: ENSMUSP00000119715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000154617]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149392
Predicted Effect probably benign
Transcript: ENSMUST00000154617
AA Change: A404V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000119715
Gene: ENSMUSG00000020516
AA Change: A404V

DomainStartEndE-ValueType
S_TKc 91 352 8.24e-107 SMART
S_TK_X 353 415 9.2e-27 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced prenatal growth, glucose intolerance, and hypoinsulinemia associated with diminished pancreatic beta cell size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Rps6kb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Rps6kb1 APN 11 86502766 missense probably benign
IGL02707:Rps6kb1 APN 11 86535410 critical splice donor site probably null
IGL03101:Rps6kb1 APN 11 86502882 missense probably benign 0.23
IGL03331:Rps6kb1 APN 11 86532830 missense probably damaging 1.00
R0025:Rps6kb1 UTSW 11 86511587 critical splice donor site probably null
R1797:Rps6kb1 UTSW 11 86502808 nonsense probably null
R1931:Rps6kb1 UTSW 11 86532821 missense possibly damaging 0.52
R2214:Rps6kb1 UTSW 11 86534070 missense possibly damaging 0.71
R3699:Rps6kb1 UTSW 11 86532794 missense probably damaging 1.00
R4171:Rps6kb1 UTSW 11 86544579 missense possibly damaging 0.68
R4291:Rps6kb1 UTSW 11 86519876 intron probably benign
R4685:Rps6kb1 UTSW 11 86519887 splice site probably null
R4727:Rps6kb1 UTSW 11 86544658 splice site probably null
R4728:Rps6kb1 UTSW 11 86544658 splice site probably null
R5450:Rps6kb1 UTSW 11 86532837 missense probably damaging 1.00
R5648:Rps6kb1 UTSW 11 86512871 missense possibly damaging 0.54
R5796:Rps6kb1 UTSW 11 86511851 missense probably benign 0.26
R5955:Rps6kb1 UTSW 11 86513605 missense probably damaging 1.00
R7080:Rps6kb1 UTSW 11 86506840 missense probably damaging 1.00
R7450:Rps6kb1 UTSW 11 86502831 missense probably benign 0.11
R7709:Rps6kb1 UTSW 11 86513322 missense probably damaging 1.00
R8084:Rps6kb1 UTSW 11 86535436 missense probably benign 0.00
R8366:Rps6kb1 UTSW 11 86511829 missense probably damaging 1.00
R8723:Rps6kb1 UTSW 11 86519931 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGATGCTGACCCACACATCATC -3'
(R):5'- AGAATATAGGGCTTGTGGCAC -3'

Sequencing Primer
(F):5'- TCCAAAGATTCAAACATTCTCACTG -3'
(R):5'- CTTGTGGCACCTTTGATTGATAG -3'
Posted On2015-02-18