Incidental Mutation 'R3196:Epdr1'
ID267666
Institutional Source Beutler Lab
Gene Symbol Epdr1
Ensembl Gene ENSMUSG00000002808
Gene Nameependymin related protein 1 (zebrafish)
SynonymsEpdr1, Epdr2, MERP-1, MERP2, MERP-2, Ucc1
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location19591706-19619927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19594645 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 94 (Y94N)
Ref Sequence ENSEMBL: ENSMUSP00000002885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002885] [ENSMUST00000220944] [ENSMUST00000221014]
Predicted Effect probably damaging
Transcript: ENSMUST00000002885
AA Change: Y94N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000002885
Gene: ENSMUSG00000002808
AA Change: Y94N

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Ependymin 87 210 1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220944
Predicted Effect probably benign
Transcript: ENSMUST00000221014
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. This protein may play a role in calcium-dependent cell adhesion. This protein is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Epdr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Epdr1 APN 13 19594509 missense possibly damaging 0.94
IGL02120:Epdr1 APN 13 19594471 missense probably damaging 1.00
IGL02716:Epdr1 APN 13 19594570 missense probably benign 0.00
ANU05:Epdr1 UTSW 13 19594644 missense probably damaging 1.00
R0586:Epdr1 UTSW 13 19594545 missense probably damaging 1.00
R1828:Epdr1 UTSW 13 19594603 nonsense probably null
R4370:Epdr1 UTSW 13 19619406 missense probably benign 0.01
R4508:Epdr1 UTSW 13 19594489 missense probably benign 0.13
R5586:Epdr1 UTSW 13 19594548 missense probably benign 0.20
R7274:Epdr1 UTSW 13 19593288 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTCTGTCAGACCACTCCTGGAC -3'
(R):5'- GGGCTAGCATGTAGTGGTTCAC -3'

Sequencing Primer
(F):5'- TGGACCAGGATCTGCTCC -3'
(R):5'- ACTTTAATTTTTCCACAGTTGGGTG -3'
Posted On2015-02-18