Incidental Mutation 'R3196:Phf1'
ID267680
Institutional Source Beutler Lab
Gene Symbol Phf1
Ensembl Gene ENSMUSG00000024193
Gene NamePHD finger protein 1
SynonymsTctex3, Tctex-3, D17Ertd455e, mPcl1, PHF2
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26933127-26937890 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26934455 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 54 (V54A)
Ref Sequence ENSEMBL: ENSMUSP00000073402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025027] [ENSMUST00000073724] [ENSMUST00000078961] [ENSMUST00000114935]
Predicted Effect probably benign
Transcript: ENSMUST00000025027
SMART Domains Protein: ENSMUSP00000025027
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
Pfam:CutA1 67 165 6.9e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073724
AA Change: V54A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073402
Gene: ENSMUSG00000024193
AA Change: V54A

DomainStartEndE-ValueType
TUDOR 29 86 5.61e-11 SMART
PHD 89 140 2.81e-8 SMART
PHD 188 238 2.42e0 SMART
low complexity region 410 416 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
Pfam:Mtf2_C 523 557 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078961
SMART Domains Protein: ENSMUSP00000077984
Gene: ENSMUSG00000024301

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
KISc 307 670 1.34e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114935
SMART Domains Protein: ENSMUSP00000110585
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CutA1 43 144 1.7e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184739
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the polycomb-like protein family, which is a component of polycomb repressive complex-2. This complex represses gene expression by catalyzing the trimethylation of histone H3 lysine 27 and is required for the regulation of developmental genes including homeotic genes. The gene is expressed primarily in testis tissue. Small interfering RNA-mediated knockdown in cultured cell lines results in changes in homeotic gene expression coincident with alterations in promoter methylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Phf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Phf1 APN 17 26936594 missense possibly damaging 0.90
IGL01629:Phf1 APN 17 26934273 missense probably benign 0.07
IGL01931:Phf1 APN 17 26935535 unclassified probably benign
IGL02008:Phf1 APN 17 26935286 missense possibly damaging 0.95
IGL02048:Phf1 APN 17 26934541 unclassified probably benign
IGL02206:Phf1 APN 17 26936869 unclassified probably benign
IGL02252:Phf1 APN 17 26935135 missense possibly damaging 0.65
IGL02548:Phf1 APN 17 26935626 missense probably damaging 1.00
IGL03145:Phf1 APN 17 26934370 critical splice donor site probably null
R0539:Phf1 UTSW 17 26934458 splice site probably null
R0815:Phf1 UTSW 17 26937140 unclassified probably benign
R0863:Phf1 UTSW 17 26937140 unclassified probably benign
R1028:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R1083:Phf1 UTSW 17 26937270 unclassified probably benign
R1537:Phf1 UTSW 17 26935398 critical splice donor site probably null
R1587:Phf1 UTSW 17 26937492 missense probably damaging 0.99
R1656:Phf1 UTSW 17 26937359 missense possibly damaging 0.93
R1956:Phf1 UTSW 17 26935745 splice site probably null
R2566:Phf1 UTSW 17 26937088 missense probably damaging 1.00
R4223:Phf1 UTSW 17 26937500 nonsense probably null
R4835:Phf1 UTSW 17 26934678 missense probably benign
R6439:Phf1 UTSW 17 26936612 missense probably benign
R7070:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R7289:Phf1 UTSW 17 26935315 missense probably damaging 1.00
R7846:Phf1 UTSW 17 26935317 nonsense probably null
R8165:Phf1 UTSW 17 26937070 missense possibly damaging 0.95
X0028:Phf1 UTSW 17 26936188 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCTATCTTGGAATAGGCCCC -3'
(R):5'- CGACACTTCTCACAGCTGAC -3'

Sequencing Primer
(F):5'- CCAGGATGCAATGGCGCAG -3'
(R):5'- AGGTACCACGGTCTCAGAG -3'
Posted On2015-02-18