Incidental Mutation 'R3196:Wac'
ID267682
Institutional Source Beutler Lab
Gene Symbol Wac
Ensembl Gene ENSMUSG00000024283
Gene NameWW domain containing adaptor with coiled-coil
Synonyms1110067P07Rik, A230035H12Rik, Wwp4
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location7868832-7973547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7917568 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 346 (V346E)
Ref Sequence ENSEMBL: ENSMUSP00000128321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074919] [ENSMUST00000092112] [ENSMUST00000166062] [ENSMUST00000167020] [ENSMUST00000168446] [ENSMUST00000169478] [ENSMUST00000170854] [ENSMUST00000171042] [ENSMUST00000171486] [ENSMUST00000172018]
Predicted Effect probably damaging
Transcript: ENSMUST00000074919
AA Change: V349E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074454
Gene: ENSMUSG00000024283
AA Change: V349E

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092112
AA Change: V291E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089746
Gene: ENSMUSG00000024283
AA Change: V291E

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 229 249 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165854
SMART Domains Protein: ENSMUSP00000126815
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 20 42 N/A INTRINSIC
WW 50 82 2.12e-7 SMART
low complexity region 265 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166062
SMART Domains Protein: ENSMUSP00000132532
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167020
AA Change: V394E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132117
Gene: ENSMUSG00000024283
AA Change: V394E

DomainStartEndE-ValueType
low complexity region 100 122 N/A INTRINSIC
WW 130 162 2.12e-7 SMART
low complexity region 252 267 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 511 526 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167057
Predicted Effect unknown
Transcript: ENSMUST00000167542
AA Change: V152E
SMART Domains Protein: ENSMUSP00000125989
Gene: ENSMUSG00000024283
AA Change: V152E

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
low complexity region 128 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168446
SMART Domains Protein: ENSMUSP00000131032
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 106 128 N/A INTRINSIC
WW 136 168 2.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169478
SMART Domains Protein: ENSMUSP00000130467
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170854
SMART Domains Protein: ENSMUSP00000131141
Gene: ENSMUSG00000024283

DomainStartEndE-ValueType
low complexity region 100 115 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171042
AA Change: V242E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133185
Gene: ENSMUSG00000024283
AA Change: V242E

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171486
AA Change: V243E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127848
Gene: ENSMUSG00000024283
AA Change: V243E

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 184 204 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172018
AA Change: V346E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128321
Gene: ENSMUSG00000024283
AA Change: V346E

DomainStartEndE-ValueType
low complexity region 55 77 N/A INTRINSIC
WW 85 117 2.12e-7 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 287 307 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Wac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02404:Wac APN 18 7917570 missense probably damaging 1.00
R1077:Wac UTSW 18 7921916 missense probably damaging 1.00
R2915:Wac UTSW 18 7926131 missense possibly damaging 0.96
R3793:Wac UTSW 18 7920190 missense possibly damaging 0.86
R3840:Wac UTSW 18 7918535 missense probably damaging 1.00
R3971:Wac UTSW 18 7916175 missense probably damaging 1.00
R6402:Wac UTSW 18 7901585 missense possibly damaging 0.71
R6429:Wac UTSW 18 7920163 missense probably damaging 0.97
R6536:Wac UTSW 18 7905189 unclassified probably null
R6615:Wac UTSW 18 7868884 unclassified probably null
R6645:Wac UTSW 18 7973523 missense probably damaging 1.00
R7088:Wac UTSW 18 7921455 missense probably damaging 0.99
R7464:Wac UTSW 18 7871746 critical splice donor site probably null
R7760:Wac UTSW 18 7921913 missense probably benign 0.43
X0066:Wac UTSW 18 7916298 critical splice donor site probably null
Z1176:Wac UTSW 18 7973531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTTGACCTTTATTGTTAGCCTG -3'
(R):5'- TGAATACCAAAGTCTACAGTGAAGG -3'

Sequencing Primer
(F):5'- AAGGGGTCAGATCCTGTAGTTAC -3'
(R):5'- TCTGGAACTAAAAATCAAGCTTTCCC -3'
Posted On2015-02-18