Incidental Mutation 'R3196:Vldlr'
ID267684
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27243154 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 598 (D598G)
Ref Sequence ENSEMBL: ENSMUSP00000126730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect probably benign
Transcript: ENSMUST00000025866
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000047645
AA Change: D557G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: D557G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164509
Predicted Effect probably damaging
Transcript: ENSMUST00000165761
AA Change: D225G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924
AA Change: D225G

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167487
AA Change: D598G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: D598G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172302
AA Change: D598G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: D598G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn C T 2: 76,856,884 probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
disturbed UTSW 19 27238804 nonsense probably null
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0537:Vldlr UTSW 19 27247918 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1443:Vldlr UTSW 19 27239721 missense possibly damaging 0.91
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1657:Vldlr UTSW 19 27245670 missense probably benign 0.00
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4795:Vldlr UTSW 19 27238852 splice site probably null
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R5889:Vldlr UTSW 19 27239664 missense probably damaging 1.00
R6110:Vldlr UTSW 19 27238077 missense possibly damaging 0.92
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
R7169:Vldlr UTSW 19 27244328 missense probably benign
R7197:Vldlr UTSW 19 27234841 missense probably benign 0.36
R7304:Vldlr UTSW 19 27238604 missense possibly damaging 0.93
R7403:Vldlr UTSW 19 27236274 nonsense probably null
R7658:Vldlr UTSW 19 27243136 missense probably benign 0.33
R7754:Vldlr UTSW 19 27217615 start codon destroyed probably benign 0.01
R8105:Vldlr UTSW 19 27238804 nonsense probably null
R8377:Vldlr UTSW 19 27234858 missense probably damaging 1.00
R8529:Vldlr UTSW 19 27230256 missense probably benign 0.03
R8777:Vldlr UTSW 19 27240546 missense probably benign 0.00
R8777-TAIL:Vldlr UTSW 19 27240546 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCATTTATCTCAAGAGCCTCAAG -3'
(R):5'- GCACCCATAATTTGTTAAGTCTGC -3'

Sequencing Primer
(F):5'- CAAGCTTAAGGGTTTCCTGATC -3'
(R):5'- AAGTCTGCCATTTTTGTTTAGCTAC -3'
Posted On2015-02-18