Mutagenetix > Incidental Mutation

Incidental Mutation 'R3411:Apcs'

267692

Institutional Source

Beutler Lab

Gene Symbol

Apcs

Ensembl Gene

ENSMUSG00000026542

Gene Name

amyloid P component, serum

Synonyms

Sap

MMRRC Submission

040629-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R3411 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172721528-172722516 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 172722130 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 72 (Y72C)

Ref Sequence

ENSEMBL: ENSMUSP00000027824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027824]

AlphaFold

P12246

Predicted Effect

probably damaging
Transcript: ENSMUST00000027824
AA Change: Y72C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027824
Gene: ENSMUSG00000026542
AA Change: Y72C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PTX	21	224	2.27e-132	SMART

Meta Mutation Damage Score

0.8034

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.6%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased antibody productions, increased autoimmune antibodies, reduced amyloidosis and glomerulonephrosis depending on strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam4	A	T	12: 81,466,596 (GRCm39)	V675D	possibly damaging	Het
Adamts16	T	C	13: 70,901,345 (GRCm39)	T911A	probably benign	Het
Adgra1	T	C	7: 139,427,619 (GRCm39)	F62S	possibly damaging	Het
Adgra3	A	G	5: 50,159,272 (GRCm39)	V326A	probably damaging	Het
Aff1	T	A	5: 103,902,572 (GRCm39)	M1K	probably null	Het
AI429214	C	T	8: 37,461,071 (GRCm39)	S73L	probably benign	Het
Apc	C	A	18: 34,402,312 (GRCm39)		probably benign	Het
Arid4a	T	C	12: 71,108,299 (GRCm39)		probably benign	Het
Armcx4	C	A	X: 133,591,774 (GRCm39)	Q561K	probably benign	Het
Atp5po	C	T	16: 91,725,794 (GRCm39)	R64H	probably damaging	Het
Bank1	G	A	3: 135,953,534 (GRCm39)		probably benign	Het
Ccdc150	A	G	1: 54,395,932 (GRCm39)	D805G	probably benign	Het
Ccdc88a	T	A	11: 29,436,006 (GRCm39)	C10S	probably damaging	Het
Dnah1	A	T	14: 30,991,774 (GRCm39)	M3076K	possibly damaging	Het
Dnpep	A	G	1: 75,293,270 (GRCm39)	V33A	probably damaging	Het
Egfem1	C	T	3: 29,637,170 (GRCm39)	T202I	probably damaging	Het
Fam120b	T	A	17: 15,651,897 (GRCm39)		probably benign	Het
Frem1	T	C	4: 82,881,416 (GRCm39)	T1263A	possibly damaging	Het
Gm6802	C	A	12: 19,540,621 (GRCm39)		noncoding transcript	Het
Golga2	C	A	2: 32,192,954 (GRCm39)	A424E	probably damaging	Het
Gpat2	G	A	2: 127,270,211 (GRCm39)	V75M	probably damaging	Het
Grik5	T	C	7: 24,762,397 (GRCm39)	D198G	probably benign	Het
Hcrtr2	A	G	9: 76,140,290 (GRCm39)	F333L	probably benign	Het
Hjurp	GT	GTT	1: 88,194,246 (GRCm39)		probably null	Het
Htr1b	A	C	9: 81,514,094 (GRCm39)	V171G	probably benign	Het
Kalrn	G	T	16: 34,032,642 (GRCm39)	D1117E	probably benign	Het
Kcp	T	C	6: 29,482,845 (GRCm39)	N1408S	possibly damaging	Het
Klhl7	G	T	5: 24,343,319 (GRCm39)	V212L	probably damaging	Het
Klra17	T	A	6: 129,851,809 (GRCm39)	N21I	probably damaging	Het
Lrrc8d	A	T	5: 105,974,572 (GRCm39)		noncoding transcript	Het
Mast2	C	G	4: 116,168,107 (GRCm39)	E881Q	possibly damaging	Het
Mcm6	T	C	1: 128,279,322 (GRCm39)	T155A	probably benign	Het
Mslnl	T	C	17: 25,963,491 (GRCm39)	F326L	probably benign	Het
Nlrp4c	A	G	7: 6,095,569 (GRCm39)	K816E	possibly damaging	Het
Or10g1	T	A	14: 52,647,818 (GRCm39)	R170S	possibly damaging	Het
Or5b101	G	C	19: 13,005,411 (GRCm39)	A94G	probably benign	Het
Or5p69	A	T	7: 107,967,551 (GRCm39)	I285F	possibly damaging	Het
Or8k3	T	C	2: 86,058,986 (GRCm39)	S110G	probably benign	Het
Otoa	A	G	7: 120,721,266 (GRCm39)	Q427R	probably damaging	Het
Pcdhb6	A	G	18: 37,468,945 (GRCm39)	E622G	probably damaging	Het
Pdzd8	A	G	19: 59,333,845 (GRCm39)	Y59H	probably damaging	Het
Psmc3	A	C	2: 90,886,263 (GRCm39)	D159A	probably damaging	Het
Ripk4	T	C	16: 97,545,157 (GRCm39)	T497A	probably benign	Het
Rpn2	C	A	2: 157,132,572 (GRCm39)	A108E	possibly damaging	Het
Serpina3n	A	G	12: 104,377,536 (GRCm39)	E263G	possibly damaging	Het
Six4	A	G	12: 73,159,657 (GRCm39)	F101S	probably damaging	Het
Slc16a4	G	A	3: 107,208,188 (GRCm39)	E233K	probably benign	Het
Smu1	T	C	4: 40,752,008 (GRCm39)	T183A	probably benign	Het
Sptb	T	G	12: 76,657,589 (GRCm39)	K1311Q	possibly damaging	Het
Styxl1	T	C	5: 135,794,618 (GRCm39)	Y83C	probably damaging	Het
Sypl2	C	T	3: 108,124,045 (GRCm39)	V166I	possibly damaging	Het
Tal2	A	G	4: 53,785,843 (GRCm39)	N8S	probably damaging	Het
Tenm4	T	C	7: 96,501,737 (GRCm39)	Y1314H	probably damaging	Het
Ttn	A	C	2: 76,772,749 (GRCm39)	N2415K	possibly damaging	Het
Usp53	T	C	3: 122,743,507 (GRCm39)		probably null	Het
Vmn2r65	T	C	7: 84,595,896 (GRCm39)	I263V	probably benign	Het

Other mutations in Apcs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01590:Apcs	APN	1	172,722,034 (GRCm39)	missense	probably damaging	0.97
R0040:Apcs	UTSW	1	172,722,023 (GRCm39)	missense	probably benign
R0040:Apcs	UTSW	1	172,722,023 (GRCm39)	missense	probably benign
R0865:Apcs	UTSW	1	172,721,782 (GRCm39)	missense	probably benign	0.30
R1691:Apcs	UTSW	1	172,722,160 (GRCm39)	missense	probably damaging	1.00
R2158:Apcs	UTSW	1	172,722,100 (GRCm39)	missense	probably damaging	1.00
R3949:Apcs	UTSW	1	172,722,259 (GRCm39)	missense	probably damaging	1.00
R4636:Apcs	UTSW	1	172,721,989 (GRCm39)	missense	probably damaging	1.00
R6911:Apcs	UTSW	1	172,721,752 (GRCm39)	missense	probably benign	0.02
R7218:Apcs	UTSW	1	172,722,231 (GRCm39)	missense	possibly damaging	0.85
R8143:Apcs	UTSW	1	172,721,900 (GRCm39)	missense	probably damaging	1.00
R8287:Apcs	UTSW	1	172,721,814 (GRCm39)	missense	possibly damaging	0.66
R8867:Apcs	UTSW	1	172,722,004 (GRCm39)	missense	possibly damaging	0.94
R9005:Apcs	UTSW	1	172,721,776 (GRCm39)	missense	probably benign	0.41
R9132:Apcs	UTSW	1	172,722,061 (GRCm39)	missense	probably damaging	0.97
R9329:Apcs	UTSW	1	172,722,391 (GRCm39)	missense	probably benign	0.00
RF005:Apcs	UTSW	1	172,721,809 (GRCm39)	missense	probably damaging	1.00
RF024:Apcs	UTSW	1	172,721,809 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAAGGCTTTCCATTGACC -3'
(R):5'- TGCTGTCAGGGAGCATAAAATG -3'

Sequencing Primer
(F):5'- AGGCTTTCCATTGACCCAAAATTC -3'
(R):5'- TGTTTGTCTGAATTTGTTGAAATGC -3'

Posted On

2015-02-18